Incidental Mutation 'R5964:Ticam1'
ID471985
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56271703 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 131 (H131N)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably damaging
Transcript: ENSMUST00000058136
AA Change: H131N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: H131N

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R7968:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATGTCCCCAACTCCAGTCTG -3'
(R):5'- TCTCTCTGGAGTCCTTGAAGATG -3'

Sequencing Primer
(F):5'- CAACTCCAGTCTGGTGTGTCAATG -3'
(R):5'- CTCTGGAGTCCTTGAAGATGAACAC -3'
Posted On2017-03-31