Incidental Mutation 'R5964:Cd226'
ID 471987
Institutional Source Beutler Lab
Gene Symbol Cd226
Ensembl Gene ENSMUSG00000034028
Gene Name CD226 antigen
Synonyms TLiSA1, DNAM-1, Pta1, DNAM1
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 89197431-89270201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89207183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 68 (H68L)
Ref Sequence ENSEMBL: ENSMUSP00000043551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037142] [ENSMUST00000097496]
AlphaFold Q8K4F0
Predicted Effect probably benign
Transcript: ENSMUST00000037142
AA Change: H68L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028
AA Change: H68L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097496
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.2394 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and increased incidence of tumor formation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Cd226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Cd226 APN 18 89269063 missense probably damaging 1.00
IGL02292:Cd226 APN 18 89207092 missense possibly damaging 0.55
IGL02298:Cd226 APN 18 89207051 missense probably damaging 1.00
IGL02408:Cd226 APN 18 89207327 missense probably benign
R0179:Cd226 UTSW 18 89207139 missense probably benign 0.00
R0558:Cd226 UTSW 18 89207214 missense probably benign 0.30
R0602:Cd226 UTSW 18 89269011 missense probably benign 0.00
R0744:Cd226 UTSW 18 89207020 intron probably benign
R0833:Cd226 UTSW 18 89207020 intron probably benign
R1125:Cd226 UTSW 18 89267922 missense probably benign
R1352:Cd226 UTSW 18 89247174 missense probably damaging 1.00
R1355:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1370:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1998:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R2004:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2006:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2045:Cd226 UTSW 18 89207362 missense probably benign 0.10
R2354:Cd226 UTSW 18 89246983 critical splice acceptor site probably null
R2518:Cd226 UTSW 18 89207327 missense probably benign
R4603:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R4804:Cd226 UTSW 18 89207168 missense possibly damaging 0.89
R5999:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R7205:Cd226 UTSW 18 89247198 missense probably damaging 1.00
R7456:Cd226 UTSW 18 89206623 missense probably damaging 0.96
R7509:Cd226 UTSW 18 89247071 missense probably benign 0.10
R7714:Cd226 UTSW 18 89247309 missense probably damaging 1.00
R9127:Cd226 UTSW 18 89269031 missense probably damaging 1.00
X0024:Cd226 UTSW 18 89263285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTCGTCATCATTGGATC -3'
(R):5'- ACTTGCACTCAGAAATGACAGC -3'

Sequencing Primer
(F):5'- GGCTTCGTCATCATTGGATCTAATC -3'
(R):5'- AAAGTTTTTCCTTACCTGACCAGAC -3'
Posted On 2017-03-31