Incidental Mutation 'R5964:Olfr1450'
ID 471989
Institutional Source Beutler Lab
Gene Symbol Olfr1450
Ensembl Gene ENSMUSG00000062892
Gene Name olfactory receptor 1450
Synonyms MOR202-33, GA_x6K02T2RE5P-3283121-3284098
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12950258-12956406 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12954531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 314 (Q314P)
Ref Sequence ENSEMBL: ENSMUSP00000150243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082006] [ENSMUST00000213587] [ENSMUST00000213925]
AlphaFold Q8VF19
Predicted Effect probably benign
Transcript: ENSMUST00000082006
AA Change: Q314P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080666
Gene: ENSMUSG00000062892
AA Change: Q314P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.5e-6 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213587
AA Change: Q314P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213925
AA Change: Q314P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Olfr1450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Olfr1450 APN 19 12954042 missense probably benign 0.00
IGL02378:Olfr1450 APN 19 12954383 missense probably benign 0.01
IGL02405:Olfr1450 APN 19 12954459 missense probably damaging 1.00
IGL02493:Olfr1450 APN 19 12953774 missense probably benign 0.12
IGL02496:Olfr1450 APN 19 12954192 missense possibly damaging 0.86
IGL02866:Olfr1450 APN 19 12954355 missense possibly damaging 0.81
IGL02886:Olfr1450 APN 19 12954518 missense probably benign 0.00
IGL03223:Olfr1450 APN 19 12953904 missense probably benign 0.00
IGL03286:Olfr1450 APN 19 12954168 missense probably benign 0.05
IGL03396:Olfr1450 APN 19 12953820 missense probably damaging 1.00
R0106:Olfr1450 UTSW 19 12954356 missense probably benign 0.10
R0106:Olfr1450 UTSW 19 12954356 missense probably benign 0.10
R0544:Olfr1450 UTSW 19 12953702 missense possibly damaging 0.79
R1660:Olfr1450 UTSW 19 12953691 missense probably damaging 1.00
R2020:Olfr1450 UTSW 19 12954332 missense possibly damaging 0.61
R4292:Olfr1450 UTSW 19 12954156 missense possibly damaging 0.83
R4647:Olfr1450 UTSW 19 12954077 missense probably benign 0.00
R6398:Olfr1450 UTSW 19 12954317 missense probably damaging 1.00
R6681:Olfr1450 UTSW 19 12954459 missense probably damaging 1.00
R7129:Olfr1450 UTSW 19 12954114 missense possibly damaging 0.94
R7399:Olfr1450 UTSW 19 12954447 missense probably damaging 1.00
R7561:Olfr1450 UTSW 19 12954039 missense probably benign 0.00
R7692:Olfr1450 UTSW 19 12953642 missense possibly damaging 0.59
R8094:Olfr1450 UTSW 19 12954002 missense probably benign 0.00
R8258:Olfr1450 UTSW 19 12954363 missense possibly damaging 0.58
R8259:Olfr1450 UTSW 19 12954363 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GAAGGCCTCCTCTACTTGTG -3'
(R):5'- CATTTGGCTAATCTGGAGTCATG -3'

Sequencing Primer
(F):5'- GCATCCCACCTTACTGCTGTAAC -3'
(R):5'- CCATTTCCAAGAGCCTCT -3'
Posted On 2017-03-31