Incidental Mutation 'R5964:Pum3'
ID 471990
Institutional Source Beutler Lab
Gene Symbol Pum3
Ensembl Gene ENSMUSG00000041360
Gene Name pumilio RNA-binding family member 3
Synonyms 1110069H02Rik, D19Bwg1357e
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R5964 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 27388702-27429820 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27420051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 308 (E308G)
Ref Sequence ENSEMBL: ENSMUSP00000075573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076219
AA Change: E308G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075573
Gene: ENSMUSG00000041360
AA Change: E308G

DomainStartEndE-ValueType
low complexity region 106 121 N/A INTRINSIC
Pumilio 165 200 1.8e-3 SMART
Pumilio 201 236 1.36e-3 SMART
Pumilio 237 273 3.72e0 SMART
Pumilio 350 385 2.54e-3 SMART
Pumilio 386 422 7.89e0 SMART
Pumilio 424 460 5.5e0 SMART
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: This gene encodes a member of the evolutionarily conserved Pumilio and Fem-3 mRNA-binding factor family of proteins, which are characterized by tandem 36 amino acid pumilio homolog domains and which function in diverse biological processes. This protein belongs to a group of atypical Pumilio and Fem-3 mRNA-binding factor proteins, whose members are distinguished from other Pumilio and Fem-3 mRNA-binding factor proteins by a novel protein fold with 11 pumilio homolog domains and an ability to bind to DNA and single- and double-stranded RNA without sequence specificity. In mouse, lower levels of gene expression have been correlated with increased testicular germ cell tumors. A pseudogene of this gene is found on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Pum3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Pum3 APN 19 27422358 missense probably damaging 0.96
IGL02368:Pum3 APN 19 27425957 missense probably benign 0.00
IGL03036:Pum3 APN 19 27421313 missense probably damaging 0.96
IGL03177:Pum3 APN 19 27390212 missense probably benign 0.29
R0242:Pum3 UTSW 19 27422755 splice site probably benign
R1480:Pum3 UTSW 19 27398910 missense probably benign 0.04
R2860:Pum3 UTSW 19 27420125 splice site probably benign
R4417:Pum3 UTSW 19 27422716 missense probably damaging 0.99
R4576:Pum3 UTSW 19 27415908 missense probably benign 0.32
R5145:Pum3 UTSW 19 27399769 missense probably damaging 1.00
R5439:Pum3 UTSW 19 27412259 missense probably benign 0.27
R5473:Pum3 UTSW 19 27418848 missense probably damaging 0.99
R5733:Pum3 UTSW 19 27421295 critical splice donor site probably null
R6516:Pum3 UTSW 19 27426008 missense probably benign
R7184:Pum3 UTSW 19 27426012 missense probably benign 0.03
R7216:Pum3 UTSW 19 27424225 missense probably damaging 1.00
R7376:Pum3 UTSW 19 27394328 missense probably benign 0.00
R7390:Pum3 UTSW 19 27424242 missense probably benign 0.11
R7761:Pum3 UTSW 19 27427092 missense probably benign
R7881:Pum3 UTSW 19 27396328 nonsense probably null
R7991:Pum3 UTSW 19 27412220 missense possibly damaging 0.93
R8300:Pum3 UTSW 19 27422373 missense probably benign 0.03
R8790:Pum3 UTSW 19 27416799 missense probably damaging 1.00
R8847:Pum3 UTSW 19 27421313 missense probably damaging 0.96
R8903:Pum3 UTSW 19 27420057 missense possibly damaging 0.48
R9042:Pum3 UTSW 19 27422391 missense probably damaging 1.00
R9401:Pum3 UTSW 19 27398936 missense probably benign
X0009:Pum3 UTSW 19 27422702 nonsense probably null
X0063:Pum3 UTSW 19 27425794 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCATCAAGAATGGTTTCAAAC -3'
(R):5'- GGAGTCGGATTCTGAAGAGTAATC -3'

Sequencing Primer
(F):5'- GATGTGGCTCCCTCAAAT -3'
(R):5'- GATCACATTTGGAGGCGTT -3'
Posted On 2017-03-31