Incidental Mutation 'R5964:Cnnm1'
ID471993
Institutional Source Beutler Lab
Gene Symbol Cnnm1
Ensembl Gene ENSMUSG00000025189
Gene Namecyclin M1
SynonymsAcdp1
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location43440436-43497210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43469723 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 658 (E658V)
Ref Sequence ENSEMBL: ENSMUSP00000153472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165311] [ENSMUST00000223787]
Predicted Effect probably benign
Transcript: ENSMUST00000165311
AA Change: E658V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131830
Gene: ENSMUSG00000025189
AA Change: E658V

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
low complexity region 78 95 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 165 183 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
Pfam:DUF21 224 414 1.8e-27 PFAM
Blast:CBS 438 489 2e-12 BLAST
CBS 505 561 5.02e0 SMART
Blast:cNMP 634 802 2e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223787
AA Change: E658V

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225421
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain protein family. The encoded protein may bind copper. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slx4 A T 16: 4,000,951 probably null Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Cnnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cnnm1 APN 19 43471936 missense probably benign 0.10
IGL02370:Cnnm1 APN 19 43471950 critical splice donor site probably null
R0329:Cnnm1 UTSW 19 43441910 missense probably damaging 1.00
R0400:Cnnm1 UTSW 19 43468364 missense probably damaging 1.00
R1417:Cnnm1 UTSW 19 43469723 missense probably benign 0.05
R1478:Cnnm1 UTSW 19 43471856 missense probably damaging 1.00
R1743:Cnnm1 UTSW 19 43471913 missense possibly damaging 0.93
R2290:Cnnm1 UTSW 19 43491502 missense probably benign
R2509:Cnnm1 UTSW 19 43441886 missense probably damaging 1.00
R2910:Cnnm1 UTSW 19 43469647 missense possibly damaging 0.58
R3107:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3109:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3922:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R3923:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R4804:Cnnm1 UTSW 19 43491575 missense probably benign 0.02
R5199:Cnnm1 UTSW 19 43494986 missense possibly damaging 0.84
R5347:Cnnm1 UTSW 19 43441862 missense probably benign 0.42
R5595:Cnnm1 UTSW 19 43465157 missense possibly damaging 0.85
R5969:Cnnm1 UTSW 19 43491472 missense probably damaging 1.00
R6383:Cnnm1 UTSW 19 43465266 critical splice donor site probably null
R7072:Cnnm1 UTSW 19 43440857 missense probably benign
R7092:Cnnm1 UTSW 19 43441948 missense probably damaging 1.00
R7126:Cnnm1 UTSW 19 43484853 missense probably damaging 1.00
R7432:Cnnm1 UTSW 19 43468271 missense probably benign 0.09
R7445:Cnnm1 UTSW 19 43440821 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGATGAAACCCCAGATGCTGC -3'
(R):5'- GTAATGCAAGGACGCCCAAC -3'

Sequencing Primer
(F):5'- AGATGCTGCACTCGCCTC -3'
(R):5'- AACCCATTGGCCTTGTTCTCTAGG -3'
Posted On2017-03-31