Incidental Mutation 'R5965:Serpinb3c'
ID 471999
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms 1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
MMRRC Submission 044150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5965 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 107271201-107278371 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107276923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
AlphaFold A2RSF9
Predicted Effect probably benign
Transcript: ENSMUST00000027565
AA Change: I31T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: I31T

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Meta Mutation Damage Score 0.4840 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Galntl6 T C 8: 57,857,531 T379A probably benign Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Lsp1 T A 7: 142,490,424 probably null Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nfia T C 4: 98,111,292 *499Q probably null Het
Nmbr C A 10: 14,766,810 R38S probably benign Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Ric1 G A 19: 29,570,771 D280N probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
BB011:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107275014 missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R6424:Serpinb3c UTSW 1 107271629 makesense probably null
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107272014 missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107276304 missense probably benign 0.03
R8189:Serpinb3c UTSW 1 107276309 missense probably benign 0.00
R8384:Serpinb3c UTSW 1 107271967 missense probably benign 0.02
R9042:Serpinb3c UTSW 1 107272001 missense probably damaging 1.00
R9518:Serpinb3c UTSW 1 107272738 missense probably damaging 0.99
R9566:Serpinb3c UTSW 1 107272695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTCTTCTCAGGCATCAAG -3'
(R):5'- CTAGTTAGAAGTACATTGCCGAAG -3'

Sequencing Primer
(F):5'- CTCAGGCATCAAGCTTTATGC -3'
(R):5'- ATGAACTGATAATTACAGAGAGATGC -3'
Posted On 2017-03-31