Incidental Mutation 'R5965:Nfia'
ID472009
Institutional Source Beutler Lab
Gene Symbol Nfia
Ensembl Gene ENSMUSG00000028565
Gene Namenuclear factor I/A
Synonyms9430022M17Rik, NF1-A, 1110047K16Rik, NF1A
MMRRC Submission 044150-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5965 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location97772734-98118874 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 98111292 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 499 (*499Q)
Ref Sequence ENSEMBL: ENSMUSP00000102677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052018] [ENSMUST00000075448] [ENSMUST00000092532] [ENSMUST00000107057] [ENSMUST00000107062]
Predicted Effect probably benign
Transcript: ENSMUST00000052018
SMART Domains Protein: ENSMUSP00000099856
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.6e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 192 487 7.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075448
SMART Domains Protein: ENSMUSP00000074899
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 6 46 5.6e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 508 1.8e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092532
SMART Domains Protein: ENSMUSP00000130032
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 318 4.1e-48 PFAM
Pfam:CTF_NFI 315 466 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107057
SMART Domains Protein: ENSMUSP00000102672
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 180 380 7.8e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107062
AA Change: *499Q
SMART Domains Protein: ENSMUSP00000102677
Gene: ENSMUSG00000028565
AA Change: *499Q

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.7e-31 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 494 6.2e-128 PFAM
Meta Mutation Damage Score 0.8640 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display perinatal lethality, hydrocephalus, agenesis of the corpus callosum and hippocampal commissure. Fertility is surviving homozygotes is compromised. A decrease in the number of heterozygous animals is associated with a maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Galntl6 T C 8: 57,857,531 T379A probably benign Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Lsp1 T A 7: 142,490,424 probably null Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nmbr C A 10: 14,766,810 R38S probably benign Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Ric1 G A 19: 29,570,771 D280N probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Serpinb3c A G 1: 107,276,923 I31T probably benign Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Nfia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Nfia APN 4 98065386 missense probably damaging 0.97
IGL02663:Nfia APN 4 98041619 missense probably benign 0.14
IGL02691:Nfia APN 4 98081808 nonsense probably null
IGL02705:Nfia APN 4 97783368 missense probably damaging 1.00
IGL03226:Nfia APN 4 98063049 missense probably damaging 0.97
R0400:Nfia UTSW 4 98063136 missense probably damaging 0.96
R0611:Nfia UTSW 4 97783457 missense possibly damaging 0.75
R1568:Nfia UTSW 4 98111224 missense possibly damaging 0.93
R1716:Nfia UTSW 4 98063128 missense probably damaging 0.98
R3855:Nfia UTSW 4 98063022 missense probably damaging 1.00
R4038:Nfia UTSW 4 98020837 missense probably damaging 1.00
R4441:Nfia UTSW 4 97772913 critical splice donor site probably null
R4849:Nfia UTSW 4 98081811 missense probably damaging 1.00
R5184:Nfia UTSW 4 97783348 missense probably damaging 0.99
R5201:Nfia UTSW 4 98111225 missense probably damaging 0.98
R5254:Nfia UTSW 4 98014297 missense probably damaging 0.99
R5391:Nfia UTSW 4 97783301 missense probably damaging 0.96
R5551:Nfia UTSW 4 98014260 missense probably damaging 0.98
R5794:Nfia UTSW 4 97783601 missense possibly damaging 0.92
R5905:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R6028:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R7246:Nfia UTSW 4 98065342 missense probably damaging 1.00
R7669:Nfia UTSW 4 97783505 missense probably damaging 0.96
X0018:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0019:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0020:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0021:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0022:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0023:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0024:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0027:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0050:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0052:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0053:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0054:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0057:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0058:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0060:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0061:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0062:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0063:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0064:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0065:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0066:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0067:Nfia UTSW 4 98041655 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGCACTGGATCACTGTGG -3'
(R):5'- TTCCAGCACCATGAGAAATTACGAC -3'

Sequencing Primer
(F):5'- GGCCTTGCTCATACTAGCCAAG -3'
(R):5'- TGAGAAATTACGACAGTCCCTAAAG -3'
Posted On2017-03-31