Incidental Mutation 'R5965:Lsp1'
ID472025
Institutional Source Beutler Lab
Gene Symbol Lsp1
Ensembl Gene ENSMUSG00000018819
Gene Namelymphocyte specific 1
Synonymspp52, leukocyte specific protein 1, WP34, lymphocyte-specific protein 1, leukocyte-specific protein 1, Lsp-1, p50
MMRRC Submission 044150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5965 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location142460809-142494867 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 142490424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018963] [ENSMUST00000038946] [ENSMUST00000105966] [ENSMUST00000105967] [ENSMUST00000105968] [ENSMUST00000140626] [ENSMUST00000149521]
Predicted Effect probably null
Transcript: ENSMUST00000018963
SMART Domains Protein: ENSMUSP00000018963
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 173 303 2.3e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038946
SMART Domains Protein: ENSMUSP00000040637
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 27 51 N/A INTRINSIC
Pfam:Caldesmon 171 301 2.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054910
SMART Domains Protein: ENSMUSP00000061994
Gene: ENSMUSG00000043795

DomainStartEndE-ValueType
Pfam:DUF4643 6 259 1.3e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105966
SMART Domains Protein: ENSMUSP00000101586
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 27 51 N/A INTRINSIC
Pfam:Caldesmon 166 294 6.4e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105967
SMART Domains Protein: ENSMUSP00000101587
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 168 296 6.7e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105968
SMART Domains Protein: ENSMUSP00000101588
Gene: ENSMUSG00000018819

DomainStartEndE-ValueType
coiled coil region 29 53 N/A INTRINSIC
Pfam:Caldesmon 173 280 9.3e-29 PFAM
low complexity region 291 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132956
Predicted Effect probably benign
Transcript: ENSMUST00000140626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142408
Predicted Effect probably null
Transcript: ENSMUST00000149521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156960
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased numbers of resident peritoneal macrophages and reduced numbers of peritoneal lymphocytes. Mutant neutrophils show abnormal morphology and impaired chemokine-induced migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Galntl6 T C 8: 57,857,531 T379A probably benign Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nfia T C 4: 98,111,292 *499Q probably null Het
Nmbr C A 10: 14,766,810 R38S probably benign Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Ric1 G A 19: 29,570,771 D280N probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Serpinb3c A G 1: 107,276,923 I31T probably benign Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Lsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Lsp1 APN 7 142488942 critical splice donor site probably null
IGL02358:Lsp1 APN 7 142488942 critical splice donor site probably null
IGL02624:Lsp1 APN 7 142490551 splice site probably benign
R0594:Lsp1 UTSW 7 142488950 splice site probably benign
R0603:Lsp1 UTSW 7 142489378 missense probably damaging 1.00
R2055:Lsp1 UTSW 7 142489407 critical splice donor site probably null
R2090:Lsp1 UTSW 7 142491807 intron probably benign
R3911:Lsp1 UTSW 7 142486361 missense probably damaging 0.98
R7186:Lsp1 UTSW 7 142490352 missense probably damaging 1.00
R7216:Lsp1 UTSW 7 142488442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCATGCTGTCCTGAATGC -3'
(R):5'- ACGAACTTGTACCGCTTTCC -3'

Sequencing Primer
(F):5'- CATGCTGTCCTGAATGCAGTATGAC -3'
(R):5'- GAACTTGTACCGCTTTCCAGATGG -3'
Posted On2017-03-31