Incidental Mutation 'R5965:Galntl6'
ID472029
Institutional Source Beutler Lab
Gene Symbol Galntl6
Ensembl Gene ENSMUSG00000096914
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms
MMRRC Submission 044150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5965 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location57774052-58912640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57857531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 379 (T379A)
Ref Sequence ENSEMBL: ENSMUSP00000145321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204128]
Predicted Effect unknown
Transcript: ENSMUST00000098757
AA Change: T194A
SMART Domains Protein: ENSMUSP00000096353
Gene: ENSMUSG00000096914
AA Change: T194A

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 1 144 1.6e-18 PFAM
Pfam:Glyco_transf_7C 113 187 3.6e-12 PFAM
RICIN 268 401 7.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204128
AA Change: T379A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000145321
Gene: ENSMUSG00000096914
AA Change: T379A

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 140 404 2.1e-9 PFAM
Pfam:Glycos_transf_2 143 328 7.3e-33 PFAM
Pfam:Glyco_tranf_2_2 143 356 1.2e-8 PFAM
Pfam:Glyco_transf_7C 297 371 6.2e-12 PFAM
RICIN 452 585 7.9e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.1%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T A 5: 30,205,639 T23S probably benign Het
Armc2 A G 10: 41,922,572 I747T possibly damaging Het
Cacna1c T A 6: 118,602,300 H1729L probably damaging Het
Crebbp A G 16: 4,087,661 probably benign Het
Cyp4f17 T A 17: 32,524,637 M326K probably damaging Het
D230025D16Rik T C 8: 105,234,539 F69L probably damaging Het
Dchs1 T G 7: 105,755,925 D2470A probably damaging Het
Ddhd2 T C 8: 25,735,777 T518A probably damaging Het
Derl2 T C 11: 71,014,552 T109A probably benign Het
Dnah7b T C 1: 46,362,987 L3994P probably damaging Het
Dock10 T C 1: 80,568,744 probably null Het
Dync1h1 T A 12: 110,632,778 S1856T probably benign Het
Ehd2 T C 7: 15,952,074 K358E possibly damaging Het
Enpp2 A G 15: 54,882,971 probably null Het
Esco1 T C 18: 10,593,867 E473G possibly damaging Het
Exoc5 A G 14: 49,034,931 F342S probably damaging Het
Fam186a T A 15: 99,945,097 T1089S probably benign Het
Fam71d T A 12: 78,710,306 N12K unknown Het
Fanca T C 8: 123,316,410 D79G possibly damaging Het
Gabrb2 A G 11: 42,626,869 Y506C probably damaging Het
Gm34768 A G 2: 11,908,505 noncoding transcript Het
Gps2 A G 11: 69,914,794 E46G possibly damaging Het
Gsdmc T C 15: 63,804,598 probably null Het
Gys1 C T 7: 45,455,339 T666I probably benign Het
Hsd17b11 T A 5: 104,021,785 probably benign Het
Iffo1 T A 6: 125,152,508 probably benign Het
Ighv1-51 T C 12: 115,131,557 noncoding transcript Het
Kansl3 T A 1: 36,345,520 probably null Het
Kdm3a A G 6: 71,621,380 I174T probably benign Het
Klhl26 A T 8: 70,452,731 D95E probably damaging Het
Lair1 T C 7: 4,029,024 D28G possibly damaging Het
Lama3 A G 18: 12,429,887 D489G possibly damaging Het
Lamb3 A T 1: 193,343,460 I1153F probably damaging Het
Lsp1 T A 7: 142,490,424 probably null Het
Man1a A G 10: 53,933,490 probably benign Het
Mcam A C 9: 44,136,628 S57R probably damaging Het
Mrgprf C A 7: 145,307,431 probably benign Het
Nfia T C 4: 98,111,292 *499Q probably null Het
Nmbr C A 10: 14,766,810 R38S probably benign Het
Olfr1126 T G 2: 87,458,037 F291V probably benign Het
Olfr191 T C 16: 59,086,303 Y60C probably damaging Het
Olfr559 C A 7: 102,724,260 V77L probably benign Het
P3h1 C T 4: 119,248,227 H741Y probably benign Het
Parp4 A T 14: 56,624,032 M941L probably benign Het
Pik3c3 C T 18: 30,298,580 T331M probably damaging Het
Prkg1 T C 19: 30,724,156 probably null Het
Qsox2 A T 2: 26,222,221 V103D probably benign Het
Ranbp1 T C 16: 18,245,228 T95A probably damaging Het
Ric1 G A 19: 29,570,771 D280N probably damaging Het
Scd1 A G 19: 44,400,140 probably null Het
Serpinb3c A G 1: 107,276,923 I31T probably benign Het
Slc7a11 T A 3: 50,379,144 Y386F probably benign Het
Smtnl2 A T 11: 72,400,453 probably null Het
Snx2 G T 18: 53,194,462 E87* probably null Het
Tars2 A C 3: 95,748,152 probably null Het
Tax1bp1 C A 6: 52,729,332 T106N probably damaging Het
Tcof1 A G 18: 60,833,418 probably null Het
Tenm3 C A 8: 48,228,508 E2680* probably null Het
Thap7 C T 16: 17,530,747 probably benign Het
Thoc6 T A 17: 23,670,868 I23F possibly damaging Het
Tmem185b T G 1: 119,526,564 Y18* probably null Het
Trav6-1 A C 14: 52,638,797 Y58S probably damaging Het
Trbv16 A T 6: 41,152,055 I58F probably benign Het
Ubtfl1 T A 9: 18,409,542 M122K probably benign Het
Vps13a T C 19: 16,619,028 probably null Het
Zdhhc24 T G 19: 4,883,750 D278E probably benign Het
Zfp316 T C 5: 143,264,672 probably null Het
Zfyve9 T C 4: 108,691,681 T769A possibly damaging Het
Znhit6 T A 3: 145,578,348 N96K possibly damaging Het
Other mutations in Galntl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Galntl6 APN 8 57857540 missense probably damaging 1.00
IGL00557:Galntl6 APN 8 58911417 missense possibly damaging 0.71
IGL01140:Galntl6 APN 8 57958322 missense probably damaging 1.00
IGL01412:Galntl6 APN 8 57777294 missense probably damaging 0.99
IGL01458:Galntl6 APN 8 58427709 missense probably damaging 1.00
IGL01575:Galntl6 APN 8 58427676 intron probably benign
IGL01700:Galntl6 APN 8 57958460 splice site probably benign
IGL01710:Galntl6 APN 8 58535968 missense probably damaging 0.97
IGL02611:Galntl6 APN 8 57958416 missense probably damaging 1.00
IGL02880:Galntl6 APN 8 57804272 missense probably benign 0.44
IGL03129:Galntl6 APN 8 58427716 missense probably damaging 1.00
IGL03215:Galntl6 APN 8 58911402 missense probably benign 0.00
IGL03249:Galntl6 APN 8 57777176 utr 3 prime probably benign
Indubitably UTSW 8 58427770 missense probably damaging 1.00
PIT4677001:Galntl6 UTSW 8 57857587 missense probably damaging 1.00
R0600:Galntl6 UTSW 8 57837183 splice site probably null
R0731:Galntl6 UTSW 8 58535984 missense probably benign
R0961:Galntl6 UTSW 8 58911340 missense probably benign
R1381:Galntl6 UTSW 8 58472955 missense probably damaging 0.99
R2137:Galntl6 UTSW 8 58535905 critical splice donor site probably null
R4632:Galntl6 UTSW 8 58427823 missense probably damaging 1.00
R4731:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4732:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4733:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4920:Galntl6 UTSW 8 58427773 missense probably damaging 0.97
R4964:Galntl6 UTSW 8 58699911 intron probably benign
R5357:Galntl6 UTSW 8 57884463 missense probably damaging 0.99
R5526:Galntl6 UTSW 8 58472970 missense probably benign
R5951:Galntl6 UTSW 8 57962402 missense probably benign 0.06
R6260:Galntl6 UTSW 8 57884481 missense probably damaging 1.00
R6368:Galntl6 UTSW 8 58911441 missense probably damaging 1.00
R6695:Galntl6 UTSW 8 58427770 missense probably damaging 1.00
R7593:Galntl6 UTSW 8 57777259 missense probably damaging 1.00
R7780:Galntl6 UTSW 8 58427699 critical splice donor site probably null
R7833:Galntl6 UTSW 8 57857537 missense probably benign
R7871:Galntl6 UTSW 8 57837188 missense probably damaging 0.98
R7916:Galntl6 UTSW 8 57857537 missense probably benign
R7954:Galntl6 UTSW 8 57837188 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGAAAACCCGTCACAGTT -3'
(R):5'- GTTGACTTCACTGTTTGGAAAATTC -3'

Sequencing Primer
(F):5'- CAGAAAACCCGTCACAGTTAATAG -3'
(R):5'- TGGAACATGATCATCTGGCC -3'
Posted On2017-03-31