Incidental Mutation 'R0502:Fcho1'
ID 47204
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 038697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R0502 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71712560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 418 (A418T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Ano1 A G 7: 144,597,215 L821P probably damaging Het
Apol10b T A 15: 77,592,149 probably benign Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccar2 A G 14: 70,140,982 S625P probably benign Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cep350 A T 1: 155,900,883 probably null Het
Chd3 A G 11: 69,354,105 V1203A probably damaging Het
Col24a1 A G 3: 145,545,316 probably benign Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
D10Wsu102e A G 10: 83,362,056 D42G probably damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dicer1 A T 12: 104,705,060 S984T probably damaging Het
Diexf A T 1: 193,114,828 probably benign Het
Dmbt1 G A 7: 131,097,673 probably null Het
Dnah7b A T 1: 46,219,544 E1965V probably damaging Het
Dpp4 G T 2: 62,364,988 N315K probably damaging Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fat4 T A 3: 39,002,924 S4256R probably damaging Het
Gpatch4 A G 3: 88,055,365 D295G probably benign Het
Gpbar1 A T 1: 74,279,392 I265F probably benign Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hacl1 A T 14: 31,622,984 probably benign Het
Hnrnpc A G 14: 52,075,172 probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifnar1 T A 16: 91,501,751 C419S probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Itga2 T G 13: 114,845,856 N1038H probably benign Het
Kif16b C T 2: 142,712,155 D908N probably benign Het
Lamc1 A G 1: 153,246,932 probably benign Het
Lrig3 A G 10: 126,008,736 T690A probably damaging Het
Lrp2 T C 2: 69,511,017 K940E probably damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mrps27 G T 13: 99,409,795 probably benign Het
Ncam1 A G 9: 49,569,818 probably benign Het
Olfr30 T C 11: 58,455,314 I212V possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Pbrm1 T G 14: 31,064,820 D631E probably benign Het
Pdc A T 1: 150,328,414 probably benign Het
Pkd1 T C 17: 24,574,792 S1818P probably damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rab35 G A 5: 115,645,664 R170Q probably benign Het
Rerg A T 6: 137,056,307 C123* probably null Het
Ros1 A G 10: 52,194,823 probably benign Het
Siglece A G 7: 43,659,931 Y68H probably damaging Het
Slc28a2 T A 2: 122,458,281 probably null Het
Slc4a11 T C 2: 130,688,157 K234E probably damaging Het
Sqor C T 2: 122,798,050 P158S probably benign Het
Tcerg1 C T 18: 42,522,956 P110S unknown Het
Tm6sf2 T A 8: 70,077,941 Y224N probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Ttll10 T C 4: 156,047,548 probably benign Het
Ubap2l A T 3: 90,009,213 L898Q probably damaging Het
Uggt1 A T 1: 36,159,946 V1207E probably damaging Het
Uhrf2 A G 19: 30,092,776 D775G probably damaging Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn1r87 T G 7: 13,131,656 T235P probably damaging Het
Vmn2r96 T A 17: 18,584,000 M504K probably benign Het
Zdbf2 A T 1: 63,305,290 I943F possibly damaging Het
Zfp78 A G 7: 6,373,158 D22G probably damaging Het
Zfp827 C T 8: 79,179,077 probably null Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGTTGTCACCGCCAATGTC -3'
(R):5'- GTCAAAATTCTGGATGCGCGGATG -3'

Sequencing Primer
(F):5'- ACCGCCAATGTCCGCAG -3'
(R):5'- GATGCGCGGATGAGTGG -3'
Posted On 2013-06-12