Incidental Mutation 'R5966:Camsap2'
ID472072
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136276592 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1251 (S1251P)
Ref Sequence ENSEMBL: ENSMUSP00000142299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably damaging
Transcript: ENSMUST00000048309
AA Change: S1257P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570
AA Change: S1257P

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181385
Predicted Effect probably damaging
Transcript: ENSMUST00000192001
AA Change: S1240P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570
AA Change: S1240P

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192314
AA Change: S1251P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570
AA Change: S1251P

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000194808
AA Change: S583P
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1997:Camsap2 UTSW 1 136271545 missense probably damaging 1.00
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4275:Camsap2 UTSW 1 136270876 missense probably benign 0.01
R4371:Camsap2 UTSW 1 136287963 missense probably damaging 1.00
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6147:Camsap2 UTSW 1 136345400 missense probably damaging 1.00
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGCATCATCTCAAACCGTG -3'
(R):5'- CAAACATGTAACTCTTTCCAGTGTC -3'

Sequencing Primer
(F):5'- CAAACCGTGTGTCCACTTTAG -3'
(R):5'- AACCAATTTGGCCATTTGGTTTC -3'
Posted On2017-03-31