Incidental Mutation 'R5966:Akna'
ID472082
Institutional Source Beutler Lab
Gene Symbol Akna
Ensembl Gene ENSMUSG00000039158
Gene NameAT-hook transcription factor
Synonyms
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63367125-63403354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63394903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 328 (S328P)
Ref Sequence ENSEMBL: ENSMUSP00000041614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035724]
Predicted Effect probably damaging
Transcript: ENSMUST00000035724
AA Change: S328P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041614
Gene: ENSMUSG00000039158
AA Change: S328P

DomainStartEndE-ValueType
low complexity region 140 153 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
Pfam:AKNA 584 681 4.6e-37 PFAM
low complexity region 760 774 N/A INTRINSIC
low complexity region 1015 1029 N/A INTRINSIC
coiled coil region 1044 1066 N/A INTRINSIC
low complexity region 1296 1317 N/A INTRINSIC
low complexity region 1319 1343 N/A INTRINSIC
coiled coil region 1353 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144095
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic or a knock-out allele exhibit partial postnatal lethality, pathogen-induced acute neutrophil responses leading to systemic inflammation and alveolar destruction, and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dld G A 12: 31,340,326 P213L probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Akna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Akna APN 4 63397873 critical splice donor site probably null
IGL00590:Akna APN 4 63371878 missense probably benign 0.00
IGL01567:Akna APN 4 63381850 missense probably benign
IGL01667:Akna APN 4 63379159 missense probably benign 0.34
IGL01820:Akna APN 4 63386258 missense probably benign 0.30
IGL01956:Akna APN 4 63379290 missense probably benign 0.04
IGL02148:Akna APN 4 63382479 splice site probably benign
IGL02502:Akna APN 4 63368203 missense probably benign 0.28
IGL02674:Akna APN 4 63370944 nonsense probably null
IGL02792:Akna APN 4 63377706 missense possibly damaging 0.73
IGL02956:Akna APN 4 63386279 missense probably benign 0.05
R0035:Akna UTSW 4 63382445 missense probably benign 0.16
R0049:Akna UTSW 4 63394635 missense probably damaging 0.97
R0133:Akna UTSW 4 63379361 nonsense probably null
R0396:Akna UTSW 4 63392126 splice site probably benign
R0422:Akna UTSW 4 63392154 missense probably damaging 1.00
R0578:Akna UTSW 4 63370910 missense probably benign
R0784:Akna UTSW 4 63376888 missense probably benign
R1264:Akna UTSW 4 63381725 splice site probably null
R1539:Akna UTSW 4 63379310 missense probably benign 0.00
R1575:Akna UTSW 4 63379333 missense probably benign 0.01
R1646:Akna UTSW 4 63383892 missense probably benign
R2115:Akna UTSW 4 63395160 missense probably benign 0.01
R2121:Akna UTSW 4 63376900 missense probably benign 0.08
R2324:Akna UTSW 4 63371802 missense possibly damaging 0.92
R2961:Akna UTSW 4 63394944 missense probably benign 0.04
R3150:Akna UTSW 4 63395353 missense possibly damaging 0.80
R3552:Akna UTSW 4 63398124 start codon destroyed probably null 0.53
R3855:Akna UTSW 4 63373468 missense probably damaging 0.98
R4023:Akna UTSW 4 63374390 missense probably benign
R4247:Akna UTSW 4 63395172 missense probably benign 0.00
R4299:Akna UTSW 4 63398032 missense possibly damaging 0.59
R4422:Akna UTSW 4 63387093 missense possibly damaging 0.86
R4499:Akna UTSW 4 63395041 missense probably benign
R4723:Akna UTSW 4 63387032 missense probably benign
R4743:Akna UTSW 4 63378613 missense probably damaging 1.00
R4780:Akna UTSW 4 63379254 missense probably benign
R4903:Akna UTSW 4 63374037 missense probably damaging 1.00
R4936:Akna UTSW 4 63395265 missense probably damaging 0.97
R5041:Akna UTSW 4 63387144 missense possibly damaging 0.67
R5276:Akna UTSW 4 63368203 missense possibly damaging 0.95
R5297:Akna UTSW 4 63381846 missense possibly damaging 0.93
R5546:Akna UTSW 4 63394959 missense probably benign 0.15
R5546:Akna UTSW 4 63395566 missense probably benign
R5773:Akna UTSW 4 63395070 missense probably benign 0.41
R6127:Akna UTSW 4 63368119 missense possibly damaging 0.67
R6176:Akna UTSW 4 63377732 missense probably benign 0.04
R6337:Akna UTSW 4 63374003 missense probably benign 0.00
R6701:Akna UTSW 4 63395280 missense probably benign
R6800:Akna UTSW 4 63398031 missense probably benign
R6931:Akna UTSW 4 63387102 missense probably benign 0.02
R7451:Akna UTSW 4 63378667 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CGACTTGAAGATGAGGGGTC -3'
(R):5'- GAATTCCGGGACTCCTTAGC -3'

Sequencing Primer
(F):5'- CTGGTAGAGCCTTGTTGCC -3'
(R):5'- AGAATGCCGAGTGCTCTG -3'
Posted On2017-03-31