Incidental Mutation 'R5966:Ubqln3'
ID 472097
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 044151-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5966 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103790906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 395 (S395T)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: S395T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: S395T

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A T 10: 115,415,717 (GRCm39) probably benign Het
Acaa2 T C 18: 74,937,223 (GRCm39) L369S probably damaging Het
Akna A G 4: 63,313,140 (GRCm39) S328P probably damaging Het
Albfm1 A G 5: 90,719,546 (GRCm39) Y214C probably damaging Het
Apc A G 18: 34,354,140 (GRCm39) probably benign Het
Brca2 C T 5: 150,466,716 (GRCm39) T2160I probably damaging Het
Camsap2 A G 1: 136,204,330 (GRCm39) S1251P probably damaging Het
Ccdc110 A G 8: 46,395,573 (GRCm39) E488G probably damaging Het
Ccdc158 T A 5: 92,797,908 (GRCm39) I411F probably damaging Het
Cd163 C T 6: 124,297,595 (GRCm39) Q914* probably null Het
Cd22 T C 7: 30,566,083 (GRCm39) D827G probably damaging Het
Ces1e A G 8: 93,946,001 (GRCm39) probably null Het
Col14a1 T C 15: 55,315,779 (GRCm39) probably null Het
Csmd3 T A 15: 47,713,135 (GRCm39) D1509V probably damaging Het
Ddx51 A G 5: 110,804,717 (GRCm39) D543G probably damaging Het
Diaph3 T A 14: 87,222,261 (GRCm39) I408F probably damaging Het
Dld G A 12: 31,390,325 (GRCm39) P213L probably damaging Het
Dnah6 T C 6: 73,037,262 (GRCm39) T3327A probably benign Het
Dnttip2 T A 3: 122,078,817 (GRCm39) probably benign Het
Dock10 T C 1: 80,546,225 (GRCm39) E791G possibly damaging Het
Ehd3 G T 17: 74,134,356 (GRCm39) W238C probably damaging Het
Ehd3 T G 17: 74,134,361 (GRCm39) L240R probably damaging Het
Ep400 A G 5: 110,824,766 (GRCm39) V2357A unknown Het
Fam20c T C 5: 138,741,932 (GRCm39) V181A probably damaging Het
Gm4781 T C 10: 100,232,814 (GRCm39) noncoding transcript Het
Gpatch8 A T 11: 102,371,058 (GRCm39) S827T unknown Het
Grm3 A T 5: 9,561,930 (GRCm39) I640N probably damaging Het
Gstm7 A G 3: 107,838,747 (GRCm39) probably benign Het
Hdac7 G T 15: 97,700,372 (GRCm39) H572Q probably damaging Het
Ift140 C T 17: 25,313,735 (GRCm39) Q1389* probably null Het
Igfn1 A G 1: 135,893,152 (GRCm39) V2099A probably damaging Het
Ik A G 18: 36,888,531 (GRCm39) N443S possibly damaging Het
Impact A G 18: 13,123,601 (GRCm39) K315E probably benign Het
Insr C A 8: 3,308,697 (GRCm39) R113L probably benign Het
Jak2 T A 19: 29,260,954 (GRCm39) Y317N possibly damaging Het
Kif18a T A 2: 109,122,411 (GRCm39) V162E probably damaging Het
L3mbtl3 A G 10: 26,207,762 (GRCm39) V319A unknown Het
Lepr T C 4: 101,649,324 (GRCm39) probably benign Het
Lmo7 C T 14: 102,137,938 (GRCm39) T647I possibly damaging Het
Mindy3 C T 2: 12,405,854 (GRCm39) R147Q probably benign Het
Mtr T C 13: 12,230,453 (GRCm39) probably null Het
Muc4 A T 16: 32,576,652 (GRCm39) probably benign Het
Nrip1 G A 16: 76,090,471 (GRCm39) T362M possibly damaging Het
Or1j17 G T 2: 36,578,074 (GRCm39) R20L probably null Het
Or1q1 T C 2: 36,886,957 (GRCm39) I45T possibly damaging Het
Or5d45 A G 2: 88,153,222 (GRCm39) S276P probably benign Het
Ovol1 G A 19: 5,601,630 (GRCm39) R131C probably damaging Het
Pcca T C 14: 122,905,998 (GRCm39) V323A probably damaging Het
Pcdhb14 A T 18: 37,581,295 (GRCm39) M134L probably benign Het
Pecam1 G A 11: 106,581,887 (GRCm39) T252M probably benign Het
Rnd3 T A 2: 51,022,536 (GRCm39) I169F probably damaging Het
Rnmt T A 18: 68,444,689 (GRCm39) D219E probably benign Het
Rufy1 A T 11: 50,292,315 (GRCm39) F491L probably benign Het
Ryr2 G T 13: 11,677,124 (GRCm39) C3242* probably null Het
Smurf2 G T 11: 106,766,727 (GRCm39) R31S possibly damaging Het
Sptbn1 A G 11: 30,074,873 (GRCm39) I1333T probably damaging Het
Stard9 G A 2: 120,527,580 (GRCm39) C1279Y probably damaging Het
Sugp2 T C 8: 70,704,753 (GRCm39) probably null Het
Sulf1 A T 1: 12,929,636 (GRCm39) D301V probably benign Het
Tbcd G T 11: 121,492,737 (GRCm39) probably benign Het
Tlr11 T C 14: 50,599,712 (GRCm39) I566T probably benign Het
Tm9sf2 T A 14: 122,374,921 (GRCm39) probably benign Het
Tnfaip8l1 T C 17: 56,478,799 (GRCm39) F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,887,433 (GRCm39) C118S probably damaging Het
Ttc13 A G 8: 125,408,959 (GRCm39) probably benign Het
Urb2 A G 8: 124,754,827 (GRCm39) D178G probably benign Het
Usf3 A G 16: 44,041,222 (GRCm39) I1901V probably benign Het
Vmn1r173 A T 7: 23,402,112 (GRCm39) I116F probably benign Het
Vmn1r69 T A 7: 10,314,717 (GRCm39) T5S probably benign Het
Wbp1l C T 19: 46,642,619 (GRCm39) R191* probably null Het
Wfikkn2 C T 11: 94,129,688 (GRCm39) R151H probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACCTGTTGGAGGAAGCCAG -3'
(R):5'- AGCTTTCTGGGTAACATAGGAC -3'

Sequencing Primer
(F):5'- TGGCAGAATCTCCTATCTGAGAG -3'
(R):5'- TCTGGGTAACATAGGACTCTTTG -3'
Posted On 2017-03-31