Mutagenetix > Incidental Mutations

Incidental Mutation 'R5966:Ubqln3'

472097

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

044151-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R5966 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104141699 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 395 (S395T)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

Predicted Effect

probably benign
Transcript: ENSMUST00000057254
AA Change: S395T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: S395T

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.0873

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	G	5: 90,571,687	Y214C	probably damaging	Het
A930009A15Rik	A	T	10: 115,579,812		probably benign	Het
Acaa2	T	C	18: 74,804,152	L369S	probably damaging	Het
Akna	A	G	4: 63,394,903	S328P	probably damaging	Het
Apc	A	G	18: 34,221,087		probably benign	Het
Brca2	C	T	5: 150,543,251	T2160I	probably damaging	Het
Camsap2	A	G	1: 136,276,592	S1251P	probably damaging	Het
Ccdc110	A	G	8: 45,942,536	E488G	probably damaging	Het
Ccdc158	T	A	5: 92,650,049	I411F	probably damaging	Het
Cd163	C	T	6: 124,320,636	Q914*	probably null	Het
Cd22	T	C	7: 30,866,658	D827G	probably damaging	Het
Ces1e	A	G	8: 93,219,373		probably null	Het
Col14a1	T	C	15: 55,452,383		probably null	Het
Csmd3	T	A	15: 47,849,739	D1509V	probably damaging	Het
Ddx51	A	G	5: 110,656,851	D543G	probably damaging	Het
Diaph3	T	A	14: 86,984,825	I408F	probably damaging	Het
Dld	G	A	12: 31,340,326	P213L	probably damaging	Het
Dnah6	T	C	6: 73,060,279	T3327A	probably benign	Het
Dnttip2	T	A	3: 122,285,168		probably benign	Het
Dock10	T	C	1: 80,568,508	E791G	possibly damaging	Het
Ehd3	G	T	17: 73,827,361	W238C	probably damaging	Het
Ehd3	T	G	17: 73,827,366	L240R	probably damaging	Het
Ep400	A	G	5: 110,676,900	V2357A	unknown	Het
Fam20c	T	C	5: 138,756,177	V181A	probably damaging	Het
Gm4781	T	C	10: 100,396,952		noncoding transcript	Het
Gpatch8	A	T	11: 102,480,232	S827T	unknown	Het
Grm3	A	T	5: 9,511,930	I640N	probably damaging	Het
Gstm7	A	G	3: 107,931,431		probably benign	Het
Hdac7	G	T	15: 97,802,491	H572Q	probably damaging	Het
Ift140	C	T	17: 25,094,761	Q1389*	probably null	Het
Igfn1	A	G	1: 135,965,414	V2099A	probably damaging	Het
Ik	A	G	18: 36,755,478	N443S	possibly damaging	Het
Impact	A	G	18: 12,990,544	K315E	probably benign	Het
Insr	C	A	8: 3,258,697	R113L	probably benign	Het
Jak2	T	A	19: 29,283,554	Y317N	possibly damaging	Het
Kif18a	T	A	2: 109,292,066	V162E	probably damaging	Het
L3mbtl3	A	G	10: 26,331,864	V319A	unknown	Het
Lepr	T	C	4: 101,792,127		probably benign	Het
Lmo7	C	T	14: 101,900,502	T647I	possibly damaging	Het
Mindy3	C	T	2: 12,401,043	R147Q	probably benign	Het
Mtr	T	C	13: 12,215,567		probably null	Het
Muc4	A	T	16: 32,756,278		probably benign	Het
Nrip1	G	A	16: 76,293,583	T362M	possibly damaging	Het
Olfr1175-ps	A	G	2: 88,322,878	S276P	probably benign	Het
Olfr346	G	T	2: 36,688,062	R20L	probably null	Het
Olfr357	T	C	2: 36,996,945	I45T	possibly damaging	Het
Ovol1	G	A	19: 5,551,602	R131C	probably damaging	Het
Pcca	T	C	14: 122,668,586	V323A	probably damaging	Het
Pcdhb14	A	T	18: 37,448,242	M134L	probably benign	Het
Pecam1	G	A	11: 106,691,061	T252M	probably benign	Het
Rnd3	T	A	2: 51,132,524	I169F	probably damaging	Het
Rnmt	T	A	18: 68,311,618	D219E	probably benign	Het
Rufy1	A	T	11: 50,401,488	F491L	probably benign	Het
Ryr2	G	T	13: 11,662,238	C3242*	probably null	Het
Smurf2	G	T	11: 106,875,901	R31S	possibly damaging	Het
Sptbn1	A	G	11: 30,124,873	I1333T	probably damaging	Het
Stard9	G	A	2: 120,697,099	C1279Y	probably damaging	Het
Sugp2	T	C	8: 70,252,103		probably null	Het
Sulf1	A	T	1: 12,859,412	D301V	probably benign	Het
Tbcd	G	T	11: 121,601,911		probably benign	Het
Tlr11	T	C	14: 50,362,255	I566T	probably benign	Het
Tm9sf2	T	A	14: 122,137,509		probably benign	Het
Tnfaip8l1	T	C	17: 56,171,799	F30L	probably benign	Het
Trav15-2-dv6-2	T	A	14: 53,649,976	C118S	probably damaging	Het
Ttc13	A	G	8: 124,682,220		probably benign	Het
Urb2	A	G	8: 124,028,088	D178G	probably benign	Het
Usf3	A	G	16: 44,220,859	I1901V	probably benign	Het
Vmn1r173	A	T	7: 23,702,687	I116F	probably benign	Het
Vmn1r69	T	A	7: 10,580,790	T5S	probably benign	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wfikkn2	C	T	11: 94,238,862	R151H	probably damaging	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AACCTGTTGGAGGAAGCCAG -3'
(R):5'- AGCTTTCTGGGTAACATAGGAC -3'

Sequencing Primer
(F):5'- TGGCAGAATCTCCTATCTGAGAG -3'
(R):5'- TCTGGGTAACATAGGACTCTTTG -3'

Posted On

2017-03-31