Incidental Mutation 'R5966:Dld'
ID472116
Institutional Source Beutler Lab
Gene Symbol Dld
Ensembl Gene ENSMUSG00000020664
Gene Namedihydrolipoamide dehydrogenase
Synonymsbranched chain alpha-keto acid dehydrogenase complex subunit E3, dihydrolipoyl dehydrogenase
MMRRC Submission 044151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5966 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31331277-31351453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31340326 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 213 (P213L)
Ref Sequence ENSEMBL: ENSMUSP00000106481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110857]
Predicted Effect probably damaging
Transcript: ENSMUST00000110857
AA Change: P213L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106481
Gene: ENSMUSG00000020664
AA Change: P213L

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 42 370 2.3e-71 PFAM
Pfam:FAD_binding_2 43 83 2.5e-7 PFAM
Pfam:GIDA 43 111 1.7e-8 PFAM
Pfam:FAD_oxidored 43 135 4.3e-10 PFAM
Pfam:NAD_binding_8 46 100 1.4e-6 PFAM
Pfam:Pyr_redox 215 298 4.9e-17 PFAM
Pfam:Pyr_redox_dim 389 498 1.6e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220415
Meta Mutation Damage Score 0.9347 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation exhibit a developmental delay at 7.5 days postcoitum and are resorbed by 9.5 days postcoitum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,571,687 Y214C probably damaging Het
A930009A15Rik A T 10: 115,579,812 probably benign Het
Acaa2 T C 18: 74,804,152 L369S probably damaging Het
Akna A G 4: 63,394,903 S328P probably damaging Het
Apc A G 18: 34,221,087 probably benign Het
Brca2 C T 5: 150,543,251 T2160I probably damaging Het
Camsap2 A G 1: 136,276,592 S1251P probably damaging Het
Ccdc110 A G 8: 45,942,536 E488G probably damaging Het
Ccdc158 T A 5: 92,650,049 I411F probably damaging Het
Cd163 C T 6: 124,320,636 Q914* probably null Het
Cd22 T C 7: 30,866,658 D827G probably damaging Het
Ces1e A G 8: 93,219,373 probably null Het
Col14a1 T C 15: 55,452,383 probably null Het
Csmd3 T A 15: 47,849,739 D1509V probably damaging Het
Ddx51 A G 5: 110,656,851 D543G probably damaging Het
Diaph3 T A 14: 86,984,825 I408F probably damaging Het
Dnah6 T C 6: 73,060,279 T3327A probably benign Het
Dnttip2 T A 3: 122,285,168 probably benign Het
Dock10 T C 1: 80,568,508 E791G possibly damaging Het
Ehd3 G T 17: 73,827,361 W238C probably damaging Het
Ehd3 T G 17: 73,827,366 L240R probably damaging Het
Ep400 A G 5: 110,676,900 V2357A unknown Het
Fam20c T C 5: 138,756,177 V181A probably damaging Het
Gm4781 T C 10: 100,396,952 noncoding transcript Het
Gpatch8 A T 11: 102,480,232 S827T unknown Het
Grm3 A T 5: 9,511,930 I640N probably damaging Het
Gstm7 A G 3: 107,931,431 probably benign Het
Hdac7 G T 15: 97,802,491 H572Q probably damaging Het
Ift140 C T 17: 25,094,761 Q1389* probably null Het
Igfn1 A G 1: 135,965,414 V2099A probably damaging Het
Ik A G 18: 36,755,478 N443S possibly damaging Het
Impact A G 18: 12,990,544 K315E probably benign Het
Insr C A 8: 3,258,697 R113L probably benign Het
Jak2 T A 19: 29,283,554 Y317N possibly damaging Het
Kif18a T A 2: 109,292,066 V162E probably damaging Het
L3mbtl3 A G 10: 26,331,864 V319A unknown Het
Lepr T C 4: 101,792,127 probably benign Het
Lmo7 C T 14: 101,900,502 T647I possibly damaging Het
Mindy3 C T 2: 12,401,043 R147Q probably benign Het
Mtr T C 13: 12,215,567 probably null Het
Muc4 A T 16: 32,756,278 probably benign Het
Nrip1 G A 16: 76,293,583 T362M possibly damaging Het
Olfr1175-ps A G 2: 88,322,878 S276P probably benign Het
Olfr346 G T 2: 36,688,062 R20L probably null Het
Olfr357 T C 2: 36,996,945 I45T possibly damaging Het
Ovol1 G A 19: 5,551,602 R131C probably damaging Het
Pcca T C 14: 122,668,586 V323A probably damaging Het
Pcdhb14 A T 18: 37,448,242 M134L probably benign Het
Pecam1 G A 11: 106,691,061 T252M probably benign Het
Rnd3 T A 2: 51,132,524 I169F probably damaging Het
Rnmt T A 18: 68,311,618 D219E probably benign Het
Rufy1 A T 11: 50,401,488 F491L probably benign Het
Ryr2 G T 13: 11,662,238 C3242* probably null Het
Smurf2 G T 11: 106,875,901 R31S possibly damaging Het
Sptbn1 A G 11: 30,124,873 I1333T probably damaging Het
Stard9 G A 2: 120,697,099 C1279Y probably damaging Het
Sugp2 T C 8: 70,252,103 probably null Het
Sulf1 A T 1: 12,859,412 D301V probably benign Het
Tbcd G T 11: 121,601,911 probably benign Het
Tlr11 T C 14: 50,362,255 I566T probably benign Het
Tm9sf2 T A 14: 122,137,509 probably benign Het
Tnfaip8l1 T C 17: 56,171,799 F30L probably benign Het
Trav15-2-dv6-2 T A 14: 53,649,976 C118S probably damaging Het
Ttc13 A G 8: 124,682,220 probably benign Het
Ubqln3 A T 7: 104,141,699 S395T probably benign Het
Urb2 A G 8: 124,028,088 D178G probably benign Het
Usf3 A G 16: 44,220,859 I1901V probably benign Het
Vmn1r173 A T 7: 23,702,687 I116F probably benign Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wfikkn2 C T 11: 94,238,862 R151H probably damaging Het
Other mutations in Dld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dld APN 12 31335577 missense probably benign
IGL00656:Dld APN 12 31349595 critical splice donor site probably null
IGL00907:Dld APN 12 31332330 unclassified probably benign
IGL01870:Dld APN 12 31335467 missense possibly damaging 0.89
IGL02654:Dld APN 12 31333917 missense probably benign 0.19
IGL02666:Dld APN 12 31332409 missense probably null 0.00
PIT4544001:Dld UTSW 12 31335557 nonsense probably null
R0973:Dld UTSW 12 31334054 missense probably damaging 1.00
R1748:Dld UTSW 12 31334746 missense probably benign
R2225:Dld UTSW 12 31341449 missense probably benign 0.01
R4614:Dld UTSW 12 31333945 nonsense probably null
R5933:Dld UTSW 12 31333983 missense probably benign 0.00
R6088:Dld UTSW 12 31340989 missense probably benign
R6190:Dld UTSW 12 31344848 missense probably damaging 1.00
R6327:Dld UTSW 12 31332191 missense probably benign
R6750:Dld UTSW 12 31332214 missense probably benign 0.00
R7149:Dld UTSW 12 31335590 missense probably benign
R7414:Dld UTSW 12 31335526 missense probably damaging 1.00
R7730:Dld UTSW 12 31340865 missense probably benign 0.00
X0065:Dld UTSW 12 31341389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGCCAGGGCTAGGAAGTG -3'
(R):5'- GGCAACCATTTAGCATTGCAGA -3'

Sequencing Primer
(F):5'- CCAGGGCTAGGAAGTGGAAGTG -3'
(R):5'- GGACTACATAGCAAGACTGTCTCTG -3'
Posted On2017-03-31