Incidental Mutation 'R5946:Serinc2'
ID472158
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5946 (G1)
Quality Score141
Status Not validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130255521 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 351 (T351K)
Ref Sequence ENSEMBL: ENSMUSP00000101618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105996
AA Change: T351K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: T351K

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120126
AA Change: T360K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: T360K

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122374
AA Change: T296K

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232
AA Change: T296K

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4497:Serinc2 UTSW 4 130254054 missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R4987:Serinc2 UTSW 4 130263027 splice site probably null
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R6898:Serinc2 UTSW 4 130255442 missense probably benign 0.13
R7264:Serinc2 UTSW 4 130258259 missense probably benign 0.00
R7526:Serinc2 UTSW 4 130258790 missense probably benign 0.03
R7835:Serinc2 UTSW 4 130275487 missense unknown
Z1176:Serinc2 UTSW 4 130253995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATACCTGTACCAGTTGG -3'
(R):5'- AATCCAGGGTTCACAGAGGG -3'

Sequencing Primer
(F):5'- CCAGTTGGTAAGCGTCATCATGAC -3'
(R):5'- CACAGAGGGTGTATTTTACTCAGG -3'
Posted On2017-03-31