Incidental Mutation 'R5946:Sorcs2'
ID 472161
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5946 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 36186427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 905 (V905G)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: V905G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: V905G

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,571,678 (GRCm39) F1137S probably damaging Het
Actr6 G T 10: 89,564,054 (GRCm39) Q73K probably benign Het
Adamtsl3 G A 7: 82,225,265 (GRCm39) G358D probably damaging Het
Aggf1 A G 13: 95,508,084 (GRCm39) V94A probably damaging Het
Arpc3 A G 5: 122,541,459 (GRCm39) Y57C probably damaging Het
Asb2 A G 12: 103,287,814 (GRCm39) Y630H probably benign Het
Atp1a1 A T 3: 101,497,090 (GRCm39) N405K probably benign Het
C6 G T 15: 4,837,996 (GRCm39) D869Y possibly damaging Het
Cds2 A G 2: 132,139,168 (GRCm39) Y137C probably damaging Het
Ceacam12 A T 7: 17,803,131 (GRCm39) E179V probably damaging Het
Chgb T A 2: 132,634,516 (GRCm39) Y153N probably benign Het
Cit T A 5: 116,135,593 (GRCm39) L1831Q probably damaging Het
Cpne8 C A 15: 90,373,191 (GRCm39) *578L probably null Het
Cspg5 A G 9: 110,080,151 (GRCm39) T440A probably damaging Het
Dnah7a A C 1: 53,598,467 (GRCm39) V1393G probably damaging Het
Dnajb8 A G 6: 88,199,575 (GRCm39) D37G probably benign Het
Dst A G 1: 34,213,273 (GRCm39) I1063M probably benign Het
Efs T G 14: 55,156,951 (GRCm39) probably null Het
Gpatch1 A G 7: 34,991,257 (GRCm39) S596P probably damaging Het
Hbs1l C A 10: 21,217,655 (GRCm39) H190Q probably benign Het
Ighm A G 12: 113,386,329 (GRCm39) V7A unknown Het
Ivd A T 2: 118,707,370 (GRCm39) I295F possibly damaging Het
Kcnq5 A C 1: 21,575,931 (GRCm39) S258A probably damaging Het
Mad1l1 G T 5: 140,247,334 (GRCm39) P331Q probably damaging Het
Mcf2l G T 8: 13,063,922 (GRCm39) G1045C probably damaging Het
Mcoln1 T A 8: 3,558,701 (GRCm39) I233N probably damaging Het
Mmp13 T C 9: 7,276,580 (GRCm39) L225P probably damaging Het
Muc5ac G A 7: 141,371,644 (GRCm39) C2615Y possibly damaging Het
Myh7b T C 2: 155,463,315 (GRCm39) F516L probably damaging Het
Obsl1 A T 1: 75,467,851 (GRCm39) S1347R probably damaging Het
Ogn A G 13: 49,771,761 (GRCm39) N207S probably benign Het
Or2h15 C A 17: 38,441,598 (GRCm39) A162S probably benign Het
Or8b12 T A 9: 37,658,330 (GRCm39) L300Q probably damaging Het
Pcdha2 G T 18: 37,074,159 (GRCm39) V597L probably damaging Het
Pcnt T A 10: 76,217,897 (GRCm39) Y2126F possibly damaging Het
Pgbd5 A T 8: 125,101,056 (GRCm39) M400K possibly damaging Het
Pklr A T 3: 89,043,503 (GRCm39) E5V probably benign Het
Pkp4 T A 2: 59,135,411 (GRCm39) D94E probably benign Het
Ppan C T 9: 20,800,969 (GRCm39) Q111* probably null Het
Prkcb A G 7: 122,143,926 (GRCm39) N330S probably benign Het
Prl4a1 T A 13: 28,202,499 (GRCm39) W25R probably damaging Het
Rars2 T A 4: 34,656,855 (GRCm39) H501Q possibly damaging Het
Ryr2 T C 13: 11,741,839 (GRCm39) D2114G probably damaging Het
Serinc2 G T 4: 130,149,314 (GRCm39) T351K possibly damaging Het
Slc22a12 A G 19: 6,587,881 (GRCm39) F358L probably damaging Het
Tekt3 G C 11: 62,985,573 (GRCm39) A460P probably damaging Het
Tm4sf1 T G 3: 57,200,289 (GRCm39) I109L possibly damaging Het
Tmc5 A T 7: 118,269,948 (GRCm39) E899D probably damaging Het
Tmem268 C T 4: 63,486,746 (GRCm39) P90S probably damaging Het
Trim38 A G 13: 23,966,717 (GRCm39) M55V probably benign Het
Trip10 T G 17: 57,557,963 (GRCm39) V50G probably damaging Het
Usp25 T A 16: 76,911,942 (GRCm39) C990* probably null Het
Uts2 A G 4: 151,083,506 (GRCm39) D39G probably benign Het
Vezf1 T A 11: 87,964,560 (GRCm39) C49* probably null Het
Wee2 T A 6: 40,440,146 (GRCm39) N431K probably null Het
Yeats2 C A 16: 20,026,513 (GRCm39) Y796* probably null Het
Zfp592 G A 7: 80,687,645 (GRCm39) G890D possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TATCTTTCACAGGGCTATCCAG -3'
(R):5'- TGACTAGTAAGTAGCCACTGAATAC -3'

Sequencing Primer
(F):5'- GCTTTTCAAGTGGACCCCCAAG -3'
(R):5'- GTAAGTAGCCACTGAATACTGTGCC -3'
Posted On 2017-03-31