Incidental Mutation 'R5946:Dnajb8'
ID472166
Institutional Source Beutler Lab
Gene Symbol Dnajb8
Ensembl Gene ENSMUSG00000048206
Gene NameDnaJ heat shock protein family (Hsp40) member B8
SynonymsmDj6, 1700016F14Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88222268-88254415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88222593 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000056592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061866]
Predicted Effect probably benign
Transcript: ENSMUST00000061866
AA Change: D37G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056592
Gene: ENSMUSG00000048206
AA Change: D37G

DomainStartEndE-ValueType
DnaJ 2 61 5.41e-33 SMART
low complexity region 155 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156018
Predicted Effect probably benign
Transcript: ENSMUST00000203827
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DNAJ/HSP40 family of proteins that regulate chaperone activity. This family member suppresses aggregation and toxicity of polyglutamine proteins, and the C-terminal tail is essential for this activity. It has been implicated as a cancer-testis antigen and as a cancer stem-like cell antigen involved in renal cell carcinoma. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Dnajb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajb8 APN 6 88222854 missense possibly damaging 0.62
IGL01671:Dnajb8 APN 6 88222920 missense probably benign 0.00
IGL01838:Dnajb8 APN 6 88223051 missense possibly damaging 0.85
IGL01976:Dnajb8 APN 6 88222526 missense probably damaging 0.99
IGL03135:Dnajb8 APN 6 88223031 missense probably damaging 1.00
R0511:Dnajb8 UTSW 6 88222485 start codon destroyed probably null 0.98
R0762:Dnajb8 UTSW 6 88223054 missense probably damaging 1.00
R2519:Dnajb8 UTSW 6 88222875 missense probably benign
R5861:Dnajb8 UTSW 6 88223106 missense possibly damaging 0.80
R6575:Dnajb8 UTSW 6 88223075 missense probably damaging 1.00
R6767:Dnajb8 UTSW 6 88222652 missense probably damaging 0.97
R6814:Dnajb8 UTSW 6 88223040 missense probably damaging 1.00
R6872:Dnajb8 UTSW 6 88223040 missense probably damaging 1.00
Z1088:Dnajb8 UTSW 6 88222845 missense probably benign
Z1176:Dnajb8 UTSW 6 88222910 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCAGAGTCAGAAGATTCCAGC -3'
(R):5'- ATCCTCAGGATTTCGGAAGGG -3'

Sequencing Primer
(F):5'- GAGTCAGAAGATTCCAGCAAGTCC -3'
(R):5'- CCTCAGGATTTCGGAAGGGATAGC -3'
Posted On2017-03-31