Mutagenetix > Incidental Mutations

Incidental Mutation 'R5946:Adamtsl3'

472172

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82576057 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 358 (G358D)

Ref Sequence

ENSEMBL: ENSMUSP00000133337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

Predicted Effect

probably benign
Transcript: ENSMUST00000173287
AA Change: G1284D

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: G1284D

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173828
AA Change: G358D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: G358D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,625,952	F1137S	probably damaging	Het
Actr6	G	T	10: 89,728,192	Q73K	probably benign	Het
Aggf1	A	G	13: 95,371,576	V94A	probably damaging	Het
Arpc3	A	G	5: 122,403,396	Y57C	probably damaging	Het
Asb2	A	G	12: 103,321,555	Y630H	probably benign	Het
Atp1a1	A	T	3: 101,589,774	N405K	probably benign	Het
C6	G	T	15: 4,808,514	D869Y	possibly damaging	Het
Cds2	A	G	2: 132,297,248	Y137C	probably damaging	Het
Ceacam12	A	T	7: 18,069,206	E179V	probably damaging	Het
Chgb	T	A	2: 132,792,596	Y153N	probably benign	Het
Cit	T	A	5: 115,997,534	L1831Q	probably damaging	Het
Cpne8	C	A	15: 90,488,988	*578L	probably null	Het
Cspg5	A	G	9: 110,251,083	T440A	probably damaging	Het
Dnah7a	A	C	1: 53,559,308	V1393G	probably damaging	Het
Dnajb8	A	G	6: 88,222,593	D37G	probably benign	Het
Dst	A	G	1: 34,174,192	I1063M	probably benign	Het
Efs	T	G	14: 54,919,494		probably null	Het
Gpatch1	A	G	7: 35,291,832	S596P	probably damaging	Het
Hbs1l	C	A	10: 21,341,756	H190Q	probably benign	Het
Ighm	A	G	12: 113,422,709	V7A	unknown	Het
Ivd	A	T	2: 118,876,889	I295F	possibly damaging	Het
Kcnq5	A	C	1: 21,505,707	S258A	probably damaging	Het
Mad1l1	G	T	5: 140,261,579	P331Q	probably damaging	Het
Mcf2l	G	T	8: 13,013,922	G1045C	probably damaging	Het
Mcoln1	T	A	8: 3,508,701	I233N	probably damaging	Het
Mmp13	T	C	9: 7,276,580	L225P	probably damaging	Het
Muc5ac	G	A	7: 141,817,907	C2615Y	possibly damaging	Het
Myh7b	T	C	2: 155,621,395	F516L	probably damaging	Het
Obsl1	A	T	1: 75,491,207	S1347R	probably damaging	Het
Ogn	A	G	13: 49,618,285	N207S	probably benign	Het
Olfr132	C	A	17: 38,130,707	A162S	probably benign	Het
Olfr874	T	A	9: 37,747,034	L300Q	probably damaging	Het
Pcdha2	G	T	18: 36,941,106	V597L	probably damaging	Het
Pcnt	T	A	10: 76,382,063	Y2126F	possibly damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Pklr	A	T	3: 89,136,196	E5V	probably benign	Het
Pkp4	T	A	2: 59,305,067	D94E	probably benign	Het
Ppan	C	T	9: 20,889,673	Q111*	probably null	Het
Prkcb	A	G	7: 122,544,703	N330S	probably benign	Het
Prl4a1	T	A	13: 28,018,516	W25R	probably damaging	Het
Rars2	T	A	4: 34,656,855	H501Q	possibly damaging	Het
Ryr2	T	C	13: 11,726,953	D2114G	probably damaging	Het
Serinc2	G	T	4: 130,255,521	T351K	possibly damaging	Het
Slc22a12	A	G	19: 6,537,851	F358L	probably damaging	Het
Sorcs2	A	C	5: 36,029,083	V905G	probably damaging	Het
Tekt3	G	C	11: 63,094,747	A460P	probably damaging	Het
Tm4sf1	T	G	3: 57,292,868	I109L	possibly damaging	Het
Tmc5	A	T	7: 118,670,725	E899D	probably damaging	Het
Tmem268	C	T	4: 63,568,509	P90S	probably damaging	Het
Trim38	A	G	13: 23,782,734	M55V	probably benign	Het
Trip10	T	G	17: 57,250,963	V50G	probably damaging	Het
Usp25	T	A	16: 77,115,054	C990*	probably null	Het
Uts2	A	G	4: 150,999,049	D39G	probably benign	Het
Vezf1	T	A	11: 88,073,734	C49*	probably null	Het
Wee2	T	A	6: 40,463,212	N431K	probably null	Het
Yeats2	C	A	16: 20,207,763	Y796*	probably null	Het
Zfp592	G	A	7: 81,037,897	G890D	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	intron	probably null
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	intron	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R7941:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCACCATTAGGACTCCATGC -3'
(R):5'- GCCTTACAGATACTGTTTCCAGAG -3'

Sequencing Primer
(F):5'- ATGCTTCTCTCTAACCTGCAATGG -3'
(R):5'- GGCAGCATTCTAGGTTAATCCAGC -3'

Posted On

2017-03-31