Incidental Mutation 'R5946:Olfr874'
ID472182
Institutional Source Beutler Lab
Gene Symbol Olfr874
Ensembl Gene ENSMUSG00000063350
Gene Nameolfactory receptor 874
SynonymsMOR161-2, GA_x6K02T2PVTD-31428850-31429782
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5946 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37745106-37748594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37747034 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 300 (L300Q)
Ref Sequence ENSEMBL: ENSMUSP00000150088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]
Predicted Effect probably damaging
Transcript: ENSMUST00000115004
AA Change: L300Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: L300Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.9e-49 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216982
AA Change: L300Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr874
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr874 APN 9 37746389 missense possibly damaging 0.89
IGL02349:Olfr874 APN 9 37746206 missense probably benign 0.03
IGL02799:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R0498:Olfr874 UTSW 9 37746254 missense probably damaging 1.00
R0690:Olfr874 UTSW 9 37746217 missense probably benign 0.01
R1053:Olfr874 UTSW 9 37746835 missense probably damaging 0.99
R1777:Olfr874 UTSW 9 37746311 missense possibly damaging 0.78
R1862:Olfr874 UTSW 9 37746968 missense probably benign
R1907:Olfr874 UTSW 9 37746433 missense probably benign 0.35
R4524:Olfr874 UTSW 9 37746866 missense possibly damaging 0.50
R4731:Olfr874 UTSW 9 37746535 missense probably benign 0.06
R4746:Olfr874 UTSW 9 37746157 missense probably benign 0.02
R4768:Olfr874 UTSW 9 37746881 missense probably damaging 1.00
R5130:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R5406:Olfr874 UTSW 9 37746647 missense probably benign 0.23
R5546:Olfr874 UTSW 9 37746524 missense probably benign 0.05
R5882:Olfr874 UTSW 9 37746632 missense probably benign 0.02
R6226:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R6705:Olfr874 UTSW 9 37746734 missense possibly damaging 0.94
R6965:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R8008:Olfr874 UTSW 9 37746793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCTCCCACTTGATTGTG -3'
(R):5'- ATCCATGAAGACCTAGTTTCTCCATAG -3'

Sequencing Primer
(F):5'- CACTTGATTGTGGTTTGTCTTTTC -3'
(R):5'- CTAGTTTCTCCATAGTGCCATAAAC -3'
Posted On2017-03-31