Mutagenetix > Incidental Mutations

Incidental Mutation 'R5946:Pcnt'

472185

Institutional Source

Beutler Lab

Gene Symbol

Pcnt

Ensembl Gene

ENSMUSG00000001151

Gene Name

pericentrin (kendrin)

Synonyms

m239Asp, m275Asp, Pcnt2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76351263-76442786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76382063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 2126 (Y2126F)

Ref Sequence

ENSEMBL: ENSMUSP00000001179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001179
AA Change: Y2126F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: Y2126F

Domain	Start	End	E-Value	Type
internal_repeat_1	7	78	2.47e-5	PROSPERO
low complexity region	104	114	N/A	INTRINSIC
coiled coil region	131	229	N/A	INTRINSIC
internal_repeat_3	241	259	6.69e-5	PROSPERO
low complexity region	313	325	N/A	INTRINSIC
internal_repeat_3	391	409	6.69e-5	PROSPERO
low complexity region	456	467	N/A	INTRINSIC
coiled coil region	468	520	N/A	INTRINSIC
coiled coil region	554	581	N/A	INTRINSIC
low complexity region	652	666	N/A	INTRINSIC
coiled coil region	727	787	N/A	INTRINSIC
coiled coil region	871	916	N/A	INTRINSIC
low complexity region	931	942	N/A	INTRINSIC
low complexity region	969	985	N/A	INTRINSIC
coiled coil region	1055	1383	N/A	INTRINSIC
coiled coil region	1429	1481	N/A	INTRINSIC
coiled coil region	1529	1567	N/A	INTRINSIC
low complexity region	1614	1624	N/A	INTRINSIC
internal_repeat_2	1916	1964	2.47e-5	PROSPERO
coiled coil region	2158	2178	N/A	INTRINSIC
coiled coil region	2211	2279	N/A	INTRINSIC
coiled coil region	2300	2421	N/A	INTRINSIC
coiled coil region	2447	2526	N/A	INTRINSIC
Pfam:PACT_coil_coil	2718	2797	5.8e-29	PFAM
internal_repeat_1	2820	2885	2.47e-5	PROSPERO
internal_repeat_2	2844	2891	2.47e-5	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217838
AA Change: Y2126F

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220395

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,625,952	F1137S	probably damaging	Het
Actr6	G	T	10: 89,728,192	Q73K	probably benign	Het
Adamtsl3	G	A	7: 82,576,057	G358D	probably damaging	Het
Aggf1	A	G	13: 95,371,576	V94A	probably damaging	Het
Arpc3	A	G	5: 122,403,396	Y57C	probably damaging	Het
Asb2	A	G	12: 103,321,555	Y630H	probably benign	Het
Atp1a1	A	T	3: 101,589,774	N405K	probably benign	Het
C6	G	T	15: 4,808,514	D869Y	possibly damaging	Het
Cds2	A	G	2: 132,297,248	Y137C	probably damaging	Het
Ceacam12	A	T	7: 18,069,206	E179V	probably damaging	Het
Chgb	T	A	2: 132,792,596	Y153N	probably benign	Het
Cit	T	A	5: 115,997,534	L1831Q	probably damaging	Het
Cpne8	C	A	15: 90,488,988	*578L	probably null	Het
Cspg5	A	G	9: 110,251,083	T440A	probably damaging	Het
Dnah7a	A	C	1: 53,559,308	V1393G	probably damaging	Het
Dnajb8	A	G	6: 88,222,593	D37G	probably benign	Het
Dst	A	G	1: 34,174,192	I1063M	probably benign	Het
Efs	T	G	14: 54,919,494		probably null	Het
Gpatch1	A	G	7: 35,291,832	S596P	probably damaging	Het
Hbs1l	C	A	10: 21,341,756	H190Q	probably benign	Het
Ighm	A	G	12: 113,422,709	V7A	unknown	Het
Ivd	A	T	2: 118,876,889	I295F	possibly damaging	Het
Kcnq5	A	C	1: 21,505,707	S258A	probably damaging	Het
Mad1l1	G	T	5: 140,261,579	P331Q	probably damaging	Het
Mcf2l	G	T	8: 13,013,922	G1045C	probably damaging	Het
Mcoln1	T	A	8: 3,508,701	I233N	probably damaging	Het
Mmp13	T	C	9: 7,276,580	L225P	probably damaging	Het
Muc5ac	G	A	7: 141,817,907	C2615Y	possibly damaging	Het
Myh7b	T	C	2: 155,621,395	F516L	probably damaging	Het
Obsl1	A	T	1: 75,491,207	S1347R	probably damaging	Het
Ogn	A	G	13: 49,618,285	N207S	probably benign	Het
Olfr132	C	A	17: 38,130,707	A162S	probably benign	Het
Olfr874	T	A	9: 37,747,034	L300Q	probably damaging	Het
Pcdha2	G	T	18: 36,941,106	V597L	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Pklr	A	T	3: 89,136,196	E5V	probably benign	Het
Pkp4	T	A	2: 59,305,067	D94E	probably benign	Het
Ppan	C	T	9: 20,889,673	Q111*	probably null	Het
Prkcb	A	G	7: 122,544,703	N330S	probably benign	Het
Prl4a1	T	A	13: 28,018,516	W25R	probably damaging	Het
Rars2	T	A	4: 34,656,855	H501Q	possibly damaging	Het
Ryr2	T	C	13: 11,726,953	D2114G	probably damaging	Het
Serinc2	G	T	4: 130,255,521	T351K	possibly damaging	Het
Slc22a12	A	G	19: 6,537,851	F358L	probably damaging	Het
Sorcs2	A	C	5: 36,029,083	V905G	probably damaging	Het
Tekt3	G	C	11: 63,094,747	A460P	probably damaging	Het
Tm4sf1	T	G	3: 57,292,868	I109L	possibly damaging	Het
Tmc5	A	T	7: 118,670,725	E899D	probably damaging	Het
Tmem268	C	T	4: 63,568,509	P90S	probably damaging	Het
Trim38	A	G	13: 23,782,734	M55V	probably benign	Het
Trip10	T	G	17: 57,250,963	V50G	probably damaging	Het
Usp25	T	A	16: 77,115,054	C990*	probably null	Het
Uts2	A	G	4: 150,999,049	D39G	probably benign	Het
Vezf1	T	A	11: 88,073,734	C49*	probably null	Het
Wee2	T	A	6: 40,463,212	N431K	probably null	Het
Yeats2	C	A	16: 20,207,763	Y796*	probably null	Het
Zfp592	G	A	7: 81,037,897	G890D	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Pcnt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01075:Pcnt	APN	10	76422904	nonsense	probably null
IGL01307:Pcnt	APN	10	76411588	missense	probably damaging	1.00
IGL01549:Pcnt	APN	10	76367486	splice site	probably null
IGL01576:Pcnt	APN	10	76368822	missense	probably damaging	0.99
IGL01611:Pcnt	APN	10	76436424	critical splice donor site	probably null
IGL01630:Pcnt	APN	10	76420246	missense	probably damaging	0.99
IGL01647:Pcnt	APN	10	76370001	nonsense	probably null
IGL01689:Pcnt	APN	10	76411653	missense	probably damaging	1.00
IGL01690:Pcnt	APN	10	76392775	missense	probably damaging	1.00
IGL01723:Pcnt	APN	10	76418499	missense	possibly damaging	0.63
IGL01920:Pcnt	APN	10	76404528	missense	probably damaging	1.00
IGL01958:Pcnt	APN	10	76433679	missense	probably damaging	0.96
IGL02210:Pcnt	APN	10	76389219	missense	possibly damaging	0.95
IGL02225:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02228:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02237:Pcnt	APN	10	76352984	missense	probably damaging	1.00
IGL02279:Pcnt	APN	10	76403765	missense	probably damaging	1.00
IGL02303:Pcnt	APN	10	76442559	splice site	probably benign
IGL02355:Pcnt	APN	10	76375162	nonsense	probably null
IGL02362:Pcnt	APN	10	76375162	nonsense	probably null
IGL02428:Pcnt	APN	10	76429256	missense	probably damaging	0.99
IGL02536:Pcnt	APN	10	76380229	missense	possibly damaging	0.68
IGL02715:Pcnt	APN	10	76368722	splice site	probably benign
IGL02800:Pcnt	APN	10	76412583	nonsense	probably null
IGL03395:Pcnt	APN	10	76436491	missense	possibly damaging	0.95
IGL02799:Pcnt	UTSW	10	76412583	nonsense	probably null
PIT4520001:Pcnt	UTSW	10	76420235	missense	probably damaging	0.99
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0109:Pcnt	UTSW	10	76389196	missense	probably benign	0.00
R0117:Pcnt	UTSW	10	76408727	nonsense	probably null
R0254:Pcnt	UTSW	10	76392580	missense	probably benign	0.10
R0392:Pcnt	UTSW	10	76384826	missense	probably benign
R0511:Pcnt	UTSW	10	76404595	missense	possibly damaging	0.66
R0570:Pcnt	UTSW	10	76412107	missense	probably damaging	1.00
R0614:Pcnt	UTSW	10	76420316	missense	probably damaging	1.00
R0635:Pcnt	UTSW	10	76404585	missense	probably damaging	1.00
R0707:Pcnt	UTSW	10	76420541	missense	probably damaging	1.00
R0749:Pcnt	UTSW	10	76381364	missense	probably damaging	1.00
R0969:Pcnt	UTSW	10	76427951	missense	probably damaging	1.00
R1172:Pcnt	UTSW	10	76393044	splice site	probably null
R1174:Pcnt	UTSW	10	76393044	splice site	probably null
R1175:Pcnt	UTSW	10	76393044	splice site	probably null
R1512:Pcnt	UTSW	10	76404662	splice site	probably null
R1542:Pcnt	UTSW	10	76389387	missense	probably benign	0.08
R1542:Pcnt	UTSW	10	76401386	missense	probably benign	0.02
R1558:Pcnt	UTSW	10	76422922	missense	possibly damaging	0.53
R1562:Pcnt	UTSW	10	76367330	missense	probably benign	0.02
R1762:Pcnt	UTSW	10	76355137	critical splice acceptor site	probably null
R1779:Pcnt	UTSW	10	76408796	missense	probably damaging	0.99
R1869:Pcnt	UTSW	10	76379906	missense	probably null	0.94
R1911:Pcnt	UTSW	10	76368816	missense	possibly damaging	0.94
R1985:Pcnt	UTSW	10	76380337	missense	possibly damaging	0.95
R1995:Pcnt	UTSW	10	76392799	nonsense	probably null
R2073:Pcnt	UTSW	10	76380380	missense	possibly damaging	0.92
R2111:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2112:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2309:Pcnt	UTSW	10	76442626	start gained	probably benign
R2902:Pcnt	UTSW	10	76375230	missense	probably damaging	0.98
R3623:Pcnt	UTSW	10	76433750	missense	probably benign	0.23
R4088:Pcnt	UTSW	10	76428014	missense	probably damaging	1.00
R4300:Pcnt	UTSW	10	76367391	missense	probably benign	0.40
R4402:Pcnt	UTSW	10	76392393	missense	probably benign	0.00
R4407:Pcnt	UTSW	10	76374870	missense	possibly damaging	0.90
R4483:Pcnt	UTSW	10	76401483	missense	probably damaging	1.00
R4647:Pcnt	UTSW	10	76354213	missense	probably benign	0.01
R4734:Pcnt	UTSW	10	76437206	missense	probably benign	0.25
R4747:Pcnt	UTSW	10	76436465	missense	possibly damaging	0.91
R4782:Pcnt	UTSW	10	76409577	missense	possibly damaging	0.62
R4795:Pcnt	UTSW	10	76370024	missense	probably benign	0.21
R4831:Pcnt	UTSW	10	76412501	missense	probably damaging	0.96
R4873:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4875:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4946:Pcnt	UTSW	10	76356185	missense	probably damaging	1.00
R5032:Pcnt	UTSW	10	76355077	missense	probably benign	0.00
R5033:Pcnt	UTSW	10	76399945	missense	possibly damaging	0.95
R5106:Pcnt	UTSW	10	76401444	missense	probably damaging	1.00
R5118:Pcnt	UTSW	10	76412168	missense	probably damaging	0.98
R5167:Pcnt	UTSW	10	76420424	missense	probably damaging	0.97
R5199:Pcnt	UTSW	10	76418544	missense	probably benign	0.09
R5223:Pcnt	UTSW	10	76380272	missense	probably damaging	0.99
R5241:Pcnt	UTSW	10	76433617	missense	probably benign	0.26
R5308:Pcnt	UTSW	10	76356325	nonsense	probably null
R5328:Pcnt	UTSW	10	76411719	missense	probably damaging	1.00
R5454:Pcnt	UTSW	10	76389547	splice site	probably null
R5543:Pcnt	UTSW	10	76412052	missense	probably benign	0.01
R5588:Pcnt	UTSW	10	76442611	missense	possibly damaging	0.74
R5647:Pcnt	UTSW	10	76385841	missense	probably benign	0.17
R5668:Pcnt	UTSW	10	76409500	missense	probably benign	0.16
R5712:Pcnt	UTSW	10	76429271	missense	probably damaging	0.96
R5714:Pcnt	UTSW	10	76420491	missense	probably damaging	1.00
R5797:Pcnt	UTSW	10	76392756	missense	probably benign	0.00
R5955:Pcnt	UTSW	10	76411622	missense	possibly damaging	0.45
R6024:Pcnt	UTSW	10	76420037	missense	possibly damaging	0.87
R6267:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R6485:Pcnt	UTSW	10	76389330	nonsense	probably null
R6605:Pcnt	UTSW	10	76429198	critical splice donor site	probably null
R6877:Pcnt	UTSW	10	76434017	missense	possibly damaging	0.94
R6882:Pcnt	UTSW	10	76427828	missense	probably benign	0.00
R6919:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R7025:Pcnt	UTSW	10	76403835	missense	probably damaging	1.00
R7098:Pcnt	UTSW	10	76384839	missense	probably benign
R7109:Pcnt	UTSW	10	76369904	missense	probably damaging	1.00
R7121:Pcnt	UTSW	10	76427927	missense	possibly damaging	0.73
R7143:Pcnt	UTSW	10	76389060	missense	possibly damaging	0.47
R7152:Pcnt	UTSW	10	76411360	splice site	probably null
R7213:Pcnt	UTSW	10	76408904	missense	probably damaging	1.00
R7368:Pcnt	UTSW	10	76400001	missense	probably benign
R7453:Pcnt	UTSW	10	76389450	missense	probably benign
R7486:Pcnt	UTSW	10	76418436	missense	probably benign	0.03
R7486:Pcnt	UTSW	10	76418437	missense	probably benign
R7538:Pcnt	UTSW	10	76399939	missense	probably benign
R7575:Pcnt	UTSW	10	76389252	missense	probably benign	0.32
R7662:Pcnt	UTSW	10	76387522	missense	probably benign	0.27
R7685:Pcnt	UTSW	10	76422808	missense	probably benign	0.14
R7764:Pcnt	UTSW	10	76354248	missense	probably benign	0.33
R7802:Pcnt	UTSW	10	76375303	splice site	probably null
R8432:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8439:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8493:Pcnt	UTSW	10	76403623	critical splice donor site	probably null
R8530:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8535:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8830:Pcnt	UTSW	10	76382174	missense	probably benign	0.03
R8878:Pcnt	UTSW	10	76408841	missense	probably damaging	1.00
R8911:Pcnt	UTSW	10	76387525	missense	probably damaging	0.98
R8988:Pcnt	UTSW	10	76409573	nonsense	probably null
R9084:Pcnt	UTSW	10	76399992	missense	probably benign	0.09
R9169:Pcnt	UTSW	10	76385738	missense	possibly damaging	0.95
R9372:Pcnt	UTSW	10	76423126	missense	probably damaging	1.00
R9411:Pcnt	UTSW	10	76423062	missense	probably damaging	0.96
Z1176:Pcnt	UTSW	10	76382157	nonsense	probably null
Z1177:Pcnt	UTSW	10	76399968	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACATTTCACAAGGCTTCCTCAG -3'
(R):5'- CTTGAGTGCACACTGAGGAG -3'

Sequencing Primer
(F):5'- GCTTCCTCAGCCCATGATCAC -3'
(R):5'- CGTATAAAGCAGGTGCCTTGC -3'

Posted On

2017-03-31