Mutagenetix > Incidental Mutation

Incidental Mutation 'R5947:Trpm1'

472229

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

044138-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64223799 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 601 (T601A)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: T601A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: T601A

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000107519
AA Change: T485A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: T485A

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
low complexity region	505	534	N/A	INTRINSIC
low complexity region	707	719	N/A	INTRINSIC
transmembrane domain	760	779	N/A	INTRINSIC
Pfam:Ion_trans	791	1004	1.3e-15	PFAM
transmembrane domain	1034	1051	N/A	INTRINSIC
low complexity region	1100	1109	N/A	INTRINSIC
PDB:3E7K\|H	1112	1163	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177102
AA Change: T485A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: T485A

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: T485A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: T601A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Meta Mutation Damage Score

0.0854

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	T	C	8: 123,967,998		probably null	Het
Abt1	T	C	13: 23,422,055	E243G	possibly damaging	Het
Afap1l1	A	G	18: 61,743,700	S361P	probably damaging	Het
Alms1	T	C	6: 85,619,712	S507P	probably benign	Het
Atp13a3	A	G	16: 30,362,700	V34A	probably benign	Het
Atpaf2	A	T	11: 60,405,882		probably benign	Het
Bbs1	A	C	19: 4,892,994	L456R	probably benign	Het
Bri3bp	G	T	5: 125,452,153	G84*	probably null	Het
Bri3bp	G	C	5: 125,452,154		probably benign	Het
Car10	A	C	11: 93,490,613	H134P	probably damaging	Het
Cntrl	A	G	2: 35,116,679	E119G	probably damaging	Het
Cxcl3	C	T	5: 90,786,316		probably benign	Het
Dirc2	T	C	16: 35,730,306	T308A	probably benign	Het
Dppa4	T	C	16: 48,291,108	V100A	possibly damaging	Het
Elmo1	G	T	13: 20,290,383	E105*	probably null	Het
Esrp2	T	G	8: 106,132,933		probably benign	Het
Exoc3l4	A	G	12: 111,422,401	K108R	possibly damaging	Het
Exph5	G	A	9: 53,375,222	R1201H	probably benign	Het
Galnt3	A	C	2: 66,084,156		probably benign	Het
Gm14486	C	T	2: 30,658,801		noncoding transcript	Het
Gna12	T	A	5: 140,760,962	I243F	probably damaging	Het
Itga5	A	T	15: 103,356,785	W232R	probably damaging	Het
Lekr1	A	T	3: 65,773,077		noncoding transcript	Het
Lrp1	C	T	10: 127,589,554		probably null	Het
Mast4	T	C	13: 102,735,640	M2215V	probably benign	Het
Mfap5	T	C	6: 122,525,986	Y52H	probably damaging	Het
Mrps31	A	G	8: 22,414,975	K127E	possibly damaging	Het
Mto1	C	T	9: 78,461,029	T485M	probably damaging	Het
Mybbp1a	G	A	11: 72,442,431	C107Y	probably damaging	Het
Nedd4	G	A	9: 72,730,850		probably benign	Het
Nek2	A	G	1: 191,829,485	E360G	probably benign	Het
Notch1	T	A	2: 26,462,528		probably benign	Het
Nubp1	T	C	16: 10,420,186		probably benign	Het
Pcdhb1	G	A	18: 37,266,673	R559H	possibly damaging	Het
Pdcd11	G	A	19: 47,129,263	V1684I	probably benign	Het
Pggt1b	G	T	18: 46,248,940	N258K	probably benign	Het
Pou6f1	C	T	15: 100,586,120	V166M	possibly damaging	Het
Pprc1	A	G	19: 46,063,672	D546G	possibly damaging	Het
Psapl1	T	C	5: 36,204,307	V81A	probably benign	Het
Rin2	T	A	2: 145,844,943		probably benign	Het
Rpf1	A	G	3: 146,506,544	F347S	probably damaging	Het
Rrp12	A	T	19: 41,870,808		probably null	Het
Ryr1	A	T	7: 29,071,924	L2557Q	probably null	Het
Slc1a7	T	C	4: 108,010,300		probably benign	Het
Slc35e2	T	A	4: 155,611,714	M186K	possibly damaging	Het
Snx6	G	T	12: 54,770,764	S116*	probably null	Het
Sptan1	T	C	2: 29,994,367		probably null	Het
Sucla2	T	A	14: 73,592,669	M382K	probably damaging	Het
Susd5	T	C	9: 114,057,591	L16P	possibly damaging	Het
Tmem260	G	A	14: 48,486,801	A369T	possibly damaging	Het
Tmprss6	A	G	15: 78,452,522	Y393H	probably damaging	Het
Tnrc6c	A	T	11: 117,722,519	Q501L	probably damaging	Het
Trim17	A	G	11: 58,965,543	Y142C	probably damaging	Het
Trim65	T	C	11: 116,128,282	R144G	probably damaging	Het
Ttn	A	T	2: 76,734,344	V28483E	probably damaging	Het
Ube2l3	G	T	16: 17,201,472		probably benign	Het
Ube2l3	T	C	16: 17,201,476		probably null	Het
Yme1l1	T	C	2: 23,195,306		probably benign	Het
Zfat	A	G	15: 68,179,957	S663P	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTGTCATTCCCGTATATCATATGG -3'
(R):5'- TGGCTGCATGTGAAAGCTAG -3'

Sequencing Primer
(F):5'- TGGTAACAGAATGAACATCGTTG -3'
(R):5'- TGAAAGCTAGGAGGCCCTGC -3'

Posted On

2017-03-31