Incidental Mutation 'R5947:Exph5'
ID 472233
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 044138-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5947 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53286522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1201 (R1201H)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect probably benign
Transcript: ENSMUST00000051014
AA Change: R1201H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: R1201H

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 124,694,737 (GRCm39) probably null Het
Abt1 T C 13: 23,606,225 (GRCm39) E243G possibly damaging Het
Afap1l1 A G 18: 61,876,771 (GRCm39) S361P probably damaging Het
Alms1 T C 6: 85,596,694 (GRCm39) S507P probably benign Het
Atp13a3 A G 16: 30,181,518 (GRCm39) V34A probably benign Het
Atpaf2 A T 11: 60,296,708 (GRCm39) probably benign Het
Bbs1 A C 19: 4,943,022 (GRCm39) L456R probably benign Het
Bri3bp G T 5: 125,529,217 (GRCm39) G84* probably null Het
Bri3bp G C 5: 125,529,218 (GRCm39) probably benign Het
Car10 A C 11: 93,381,439 (GRCm39) H134P probably damaging Het
Cntrl A G 2: 35,006,691 (GRCm39) E119G probably damaging Het
Cxcl3 C T 5: 90,934,175 (GRCm39) probably benign Het
Dppa4 T C 16: 48,111,471 (GRCm39) V100A possibly damaging Het
Elmo1 G T 13: 20,474,553 (GRCm39) E105* probably null Het
Esrp2 T G 8: 106,859,565 (GRCm39) probably benign Het
Exoc3l4 A G 12: 111,388,835 (GRCm39) K108R possibly damaging Het
Galnt3 A C 2: 65,914,500 (GRCm39) probably benign Het
Gm14486 C T 2: 30,548,813 (GRCm39) noncoding transcript Het
Gna12 T A 5: 140,746,717 (GRCm39) I243F probably damaging Het
Itga5 A T 15: 103,265,212 (GRCm39) W232R probably damaging Het
Lekr1 A T 3: 65,680,498 (GRCm39) noncoding transcript Het
Lrp1 C T 10: 127,425,423 (GRCm39) probably null Het
Mast4 T C 13: 102,872,148 (GRCm39) M2215V probably benign Het
Mfap5 T C 6: 122,502,945 (GRCm39) Y52H probably damaging Het
Mrps31 A G 8: 22,904,991 (GRCm39) K127E possibly damaging Het
Mto1 C T 9: 78,368,311 (GRCm39) T485M probably damaging Het
Mybbp1a G A 11: 72,333,257 (GRCm39) C107Y probably damaging Het
Nedd4 G A 9: 72,638,132 (GRCm39) probably benign Het
Nek2 A G 1: 191,561,597 (GRCm39) E360G probably benign Het
Notch1 T A 2: 26,352,540 (GRCm39) probably benign Het
Nubp1 T C 16: 10,238,050 (GRCm39) probably benign Het
Pcdhb1 G A 18: 37,399,726 (GRCm39) R559H possibly damaging Het
Pdcd11 G A 19: 47,117,702 (GRCm39) V1684I probably benign Het
Pggt1b G T 18: 46,382,007 (GRCm39) N258K probably benign Het
Pou6f1 C T 15: 100,484,001 (GRCm39) V166M possibly damaging Het
Pprc1 A G 19: 46,052,111 (GRCm39) D546G possibly damaging Het
Psapl1 T C 5: 36,361,651 (GRCm39) V81A probably benign Het
Rin2 T A 2: 145,686,863 (GRCm39) probably benign Het
Rpf1 A G 3: 146,212,299 (GRCm39) F347S probably damaging Het
Rrp12 A T 19: 41,859,247 (GRCm39) probably null Het
Ryr1 A T 7: 28,771,349 (GRCm39) L2557Q probably null Het
Slc1a7 T C 4: 107,867,497 (GRCm39) probably benign Het
Slc35e2 T A 4: 155,696,171 (GRCm39) M186K possibly damaging Het
Slc49a4 T C 16: 35,550,676 (GRCm39) T308A probably benign Het
Snx6 G T 12: 54,817,549 (GRCm39) S116* probably null Het
Sptan1 T C 2: 29,884,379 (GRCm39) probably null Het
Sucla2 T A 14: 73,830,109 (GRCm39) M382K probably damaging Het
Susd5 T C 9: 113,886,659 (GRCm39) L16P possibly damaging Het
Tmem260 G A 14: 48,724,258 (GRCm39) A369T possibly damaging Het
Tmprss6 A G 15: 78,336,722 (GRCm39) Y393H probably damaging Het
Tnrc6c A T 11: 117,613,345 (GRCm39) Q501L probably damaging Het
Trim17 A G 11: 58,856,369 (GRCm39) Y142C probably damaging Het
Trim65 T C 11: 116,019,108 (GRCm39) R144G probably damaging Het
Trpm1 A G 7: 63,873,547 (GRCm39) T601A probably benign Het
Ttn A T 2: 76,564,688 (GRCm39) V28483E probably damaging Het
Ube2l3 T C 16: 17,019,340 (GRCm39) probably null Het
Ube2l3 G T 16: 17,019,336 (GRCm39) probably benign Het
Yme1l1 T C 2: 23,085,318 (GRCm39) probably benign Het
Zfat A G 15: 68,051,806 (GRCm39) S663P probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATCAGTCCTGGGCATGGATG -3'
(R):5'- TCTAAGTGAATCGGTACCTTGTG -3'

Sequencing Primer
(F):5'- ATGGATGCTTCTCCTGTAATACCCAG -3'
(R):5'- AAGTGAATCGGTACCTTGTGTGTAC -3'
Posted On 2017-03-31