Mutagenetix > Incidental Mutations

Incidental Mutation 'R5947:Nedd4'

472234

Institutional Source

Beutler Lab

Gene Symbol

Nedd4

Ensembl Gene

ENSMUSG00000032216

Gene Name

neural precursor cell expressed, developmentally down-regulated 4

Synonyms

Nedd4, Nedd4-1, Nedd4a

MMRRC Submission

044138-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72662346-72749852 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 72730850 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034740]

PDB Structure

Crystal structure of the Nedd4 C2/Grb10 SH2 complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034740

SMART Domains

Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216

Domain	Start	End	E-Value	Type
C2	79	181	5.38e-21	SMART
WW	250	282	2.32e-13	SMART
low complexity region	283	293	N/A	INTRINSIC
WW	406	438	1.31e-12	SMART
WW	461	493	1.26e-14	SMART
HECTc	550	886	2.37e-194	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194508

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	T	C	8: 123,967,998		probably null	Het
Abt1	T	C	13: 23,422,055	E243G	possibly damaging	Het
Afap1l1	A	G	18: 61,743,700	S361P	probably damaging	Het
Alms1	T	C	6: 85,619,712	S507P	probably benign	Het
Atp13a3	A	G	16: 30,362,700	V34A	probably benign	Het
Atpaf2	A	T	11: 60,405,882		probably benign	Het
Bbs1	A	C	19: 4,892,994	L456R	probably benign	Het
Bri3bp	G	T	5: 125,452,153	G84*	probably null	Het
Bri3bp	G	C	5: 125,452,154		probably benign	Het
Car10	A	C	11: 93,490,613	H134P	probably damaging	Het
Cntrl	A	G	2: 35,116,679	E119G	probably damaging	Het
Cxcl3	C	T	5: 90,786,316		probably benign	Het
Dirc2	T	C	16: 35,730,306	T308A	probably benign	Het
Dppa4	T	C	16: 48,291,108	V100A	possibly damaging	Het
Elmo1	G	T	13: 20,290,383	E105*	probably null	Het
Esrp2	T	G	8: 106,132,933		probably benign	Het
Exoc3l4	A	G	12: 111,422,401	K108R	possibly damaging	Het
Exph5	G	A	9: 53,375,222	R1201H	probably benign	Het
Galnt3	A	C	2: 66,084,156		probably benign	Het
Gm14486	C	T	2: 30,658,801		noncoding transcript	Het
Gna12	T	A	5: 140,760,962	I243F	probably damaging	Het
Itga5	A	T	15: 103,356,785	W232R	probably damaging	Het
Lekr1	A	T	3: 65,773,077		noncoding transcript	Het
Lrp1	C	T	10: 127,589,554		probably null	Het
Mast4	T	C	13: 102,735,640	M2215V	probably benign	Het
Mfap5	T	C	6: 122,525,986	Y52H	probably damaging	Het
Mrps31	A	G	8: 22,414,975	K127E	possibly damaging	Het
Mto1	C	T	9: 78,461,029	T485M	probably damaging	Het
Mybbp1a	G	A	11: 72,442,431	C107Y	probably damaging	Het
Nek2	A	G	1: 191,829,485	E360G	probably benign	Het
Notch1	T	A	2: 26,462,528		probably benign	Het
Nubp1	T	C	16: 10,420,186		probably benign	Het
Pcdhb1	G	A	18: 37,266,673	R559H	possibly damaging	Het
Pdcd11	G	A	19: 47,129,263	V1684I	probably benign	Het
Pggt1b	G	T	18: 46,248,940	N258K	probably benign	Het
Pou6f1	C	T	15: 100,586,120	V166M	possibly damaging	Het
Pprc1	A	G	19: 46,063,672	D546G	possibly damaging	Het
Psapl1	T	C	5: 36,204,307	V81A	probably benign	Het
Rin2	T	A	2: 145,844,943		probably benign	Het
Rpf1	A	G	3: 146,506,544	F347S	probably damaging	Het
Rrp12	A	T	19: 41,870,808		probably null	Het
Ryr1	A	T	7: 29,071,924	L2557Q	probably null	Het
Slc1a7	T	C	4: 108,010,300		probably benign	Het
Slc35e2	T	A	4: 155,611,714	M186K	possibly damaging	Het
Snx6	G	T	12: 54,770,764	S116*	probably null	Het
Sptan1	T	C	2: 29,994,367		probably null	Het
Sucla2	T	A	14: 73,592,669	M382K	probably damaging	Het
Susd5	T	C	9: 114,057,591	L16P	possibly damaging	Het
Tmem260	G	A	14: 48,486,801	A369T	possibly damaging	Het
Tmprss6	A	G	15: 78,452,522	Y393H	probably damaging	Het
Tnrc6c	A	T	11: 117,722,519	Q501L	probably damaging	Het
Trim17	A	G	11: 58,965,543	Y142C	probably damaging	Het
Trim65	T	C	11: 116,128,282	R144G	probably damaging	Het
Trpm1	A	G	7: 64,223,799	T601A	probably benign	Het
Ttn	A	T	2: 76,734,344	V28483E	probably damaging	Het
Ube2l3	G	T	16: 17,201,472		probably benign	Het
Ube2l3	T	C	16: 17,201,476		probably null	Het
Yme1l1	T	C	2: 23,195,306		probably benign	Het
Zfat	A	G	15: 68,179,957	S663P	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Nedd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Nedd4	APN	9	72735089	missense	probably damaging	1.00
IGL00573:Nedd4	APN	9	72686056	splice site	probably null
IGL01973:Nedd4	APN	9	72736934	missense	possibly damaging	0.81
IGL02177:Nedd4	APN	9	72747157	missense	probably damaging	1.00
IGL03082:Nedd4	APN	9	72677394	critical splice donor site	probably null
Evaporation	UTSW	9	72686095	missense	probably damaging	1.00
Reduction	UTSW	9	72731271	missense	possibly damaging	0.49
Sublimation	UTSW	9	72677379	nonsense	probably null
R0194:Nedd4	UTSW	9	72670053	missense	possibly damaging	0.72
R0714:Nedd4	UTSW	9	72731446	splice site	probably benign
R1331:Nedd4	UTSW	9	72677386	missense	probably damaging	1.00
R1633:Nedd4	UTSW	9	72671257	missense	possibly damaging	0.50
R1764:Nedd4	UTSW	9	72730907	missense	probably damaging	0.99
R2192:Nedd4	UTSW	9	72742718	missense	probably damaging	0.99
R2196:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2220:Nedd4	UTSW	9	72736707	missense	probably damaging	1.00
R2850:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2994:Nedd4	UTSW	9	72730903	missense	probably benign	0.04
R3040:Nedd4	UTSW	9	72669961	missense	probably benign
R3697:Nedd4	UTSW	9	72740187	missense	probably damaging	1.00
R3884:Nedd4	UTSW	9	72725077	missense	probably benign	0.16
R4475:Nedd4	UTSW	9	72671239	nonsense	probably null
R4476:Nedd4	UTSW	9	72671239	nonsense	probably null
R4883:Nedd4	UTSW	9	72740233	splice site	probably null
R5066:Nedd4	UTSW	9	72710519	missense	probably damaging	1.00
R5974:Nedd4	UTSW	9	72743638	critical splice donor site	probably null
R6247:Nedd4	UTSW	9	72726438	missense	probably damaging	1.00
R6651:Nedd4	UTSW	9	72731271	missense	possibly damaging	0.49
R6661:Nedd4	UTSW	9	72686095	missense	probably damaging	1.00
R7170:Nedd4	UTSW	9	72670099	missense	probably benign	0.00
R7237:Nedd4	UTSW	9	72725064	missense	probably benign	0.04
R7653:Nedd4	UTSW	9	72743628	missense	probably damaging	1.00
R7772:Nedd4	UTSW	9	72677326	missense	possibly damaging	0.77
R7905:Nedd4	UTSW	9	72677379	nonsense	probably null
R8194:Nedd4	UTSW	9	72686107	missense	probably damaging	1.00
R8229:Nedd4	UTSW	9	72731388	missense	probably benign	0.00
R8422:Nedd4	UTSW	9	72742682	missense	probably damaging	0.99
R8487:Nedd4	UTSW	9	72670039	missense	probably damaging	0.98
R8733:Nedd4	UTSW	9	72726484	missense	possibly damaging	0.80
Z1088:Nedd4	UTSW	9	72670078	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- CTCCCAGCAGTATCTTCCAGAAG -3'
(R):5'- GCATCCCAAGGTACAAAATGTC -3'

Sequencing Primer
(F):5'- GCTGTGAGCTCTTGTCTCAAAAAGC -3'
(R):5'- TGTCTGAAATAGTGAAGTGAGCTC -3'

Posted On

2017-03-31