Incidental Mutation 'R5947:Tnrc6c'
ID 472241
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Name trinucleotide repeat containing 6C
Synonyms 9930033H14Rik
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5947 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 117654289-117763439 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117722519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 501 (Q501L)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026658
AA Change: Q661L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: Q661L

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106344
AA Change: Q661L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: Q661L

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138299
AA Change: Q501L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: Q501L

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Meta Mutation Damage Score 0.2652 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117758086 missense probably benign 0.00
R8679:Tnrc6c UTSW 11 117714135 missense probably benign
R8824:Tnrc6c UTSW 11 117739854 splice site probably benign
R8971:Tnrc6c UTSW 11 117749263 missense possibly damaging 0.95
R9261:Tnrc6c UTSW 11 117714279 missense probably damaging 0.99
R9283:Tnrc6c UTSW 11 117700804 missense unknown
R9342:Tnrc6c UTSW 11 117739894 missense probably benign 0.01
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117732177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCCTGGCAGTGAACACATG -3'
(R):5'- CACCCCGATACTGAAGAGGTATTTG -3'

Sequencing Primer
(F):5'- CATCTTCTGGAACTACAGCAAGTG -3'
(R):5'- TGTACTGTTCATGATGGACCC -3'
Posted On 2017-03-31