Incidental Mutation 'R5948:Parvb'
ID472296
Institutional Source Beutler Lab
Gene Symbol Parvb
Ensembl Gene ENSMUSG00000022438
Gene Nameparvin, beta
Synonymsaffixin, D15Gsk1
MMRRC Submission 043244-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5948 (G1)
Quality Score173
Status Not validated
Chromosome15
Chromosomal Location84232043-84315688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84303461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 257 (V257M)
Ref Sequence ENSEMBL: ENSMUSP00000023072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023072]
Predicted Effect probably damaging
Transcript: ENSMUST00000023072
AA Change: V257M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023072
Gene: ENSMUSG00000022438
AA Change: V257M

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
CH 90 190 3.46e-1 SMART
low complexity region 204 211 N/A INTRINSIC
CH 257 360 9.18e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Disruption of this marker has no apparent adverse consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 T C 3: 37,083,355 probably null Het
Adam8 G T 7: 139,987,884 D341E probably benign Het
Ankrd6 T C 4: 32,817,075 T351A possibly damaging Het
Ccdc150 T C 1: 54,277,714 S251P possibly damaging Het
Cfh T C 1: 140,108,808 N629S probably damaging Het
Col4a2 T C 8: 11,420,600 S453P probably benign Het
Csf2 T C 11: 54,247,688 D109G probably benign Het
Dapk1 C A 13: 60,729,395 H483N probably damaging Het
Dnah7c T G 1: 46,672,497 I2628R probably benign Het
Dsp T C 13: 38,195,401 Y2041H possibly damaging Het
Dusp10 A G 1: 184,068,876 N280S probably benign Het
Efhc1 T A 1: 20,972,828 Y324N probably damaging Het
Epsti1 T C 14: 77,939,890 L170P probably damaging Het
Fbn2 C T 18: 58,037,049 G2217R probably damaging Het
Fryl A G 5: 73,097,372 probably null Het
Mrpl39 T C 16: 84,725,153 N244D probably benign Het
Nptxr C T 15: 79,789,841 A445T probably benign Het
Olfr344 A G 2: 36,569,351 Y251C probably damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Piezo1 T C 8: 122,483,347 E2258G probably benign Het
Prpf8 A G 11: 75,509,189 E2303G possibly damaging Het
Psmc6 A G 14: 45,334,657 D88G probably benign Het
Rbbp6 C T 7: 122,997,628 T701I probably damaging Het
Rtl1 T A 12: 109,590,599 D1602V possibly damaging Het
Rubcnl T C 14: 75,047,616 L525P probably damaging Het
Sbf2 T C 7: 110,489,285 D73G probably damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Shank2 A G 7: 144,407,223 K469E probably damaging Het
Ttc41 T C 10: 86,713,224 L94P probably damaging Het
Ttf1 G A 2: 29,073,920 A603T possibly damaging Het
Usp9y A T Y: 1,324,996 H1686Q possibly damaging Het
Vps37a A G 8: 40,540,711 E249G possibly damaging Het
Zfp273 A G 13: 67,825,799 I316V probably benign Het
Zfp600 T A 4: 146,195,075 N104K probably damaging Het
Other mutations in Parvb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Parvb APN 15 84303465 missense probably damaging 1.00
IGL02415:Parvb APN 15 84292815 missense probably damaging 1.00
IGL02458:Parvb APN 15 84303434 missense probably damaging 1.00
IGL02937:Parvb APN 15 84308953 missense probably damaging 1.00
IGL03088:Parvb APN 15 84308843 splice site probably benign
R0422:Parvb UTSW 15 84295611 missense probably benign 0.28
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1713:Parvb UTSW 15 84297991 splice site probably benign
R2031:Parvb UTSW 15 84282835 missense probably benign 0.09
R2146:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2148:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2149:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2150:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2508:Parvb UTSW 15 84297970 missense probably benign
R4770:Parvb UTSW 15 84303905 critical splice donor site probably null
R6492:Parvb UTSW 15 84303872 missense probably damaging 1.00
R6718:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6719:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6720:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6722:Parvb UTSW 15 84297979 missense probably damaging 0.96
R7189:Parvb UTSW 15 84303471 critical splice donor site probably null
R7285:Parvb UTSW 15 84282784 missense possibly damaging 0.94
R7492:Parvb UTSW 15 84290450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGTTAAGGCAACCCTCACG -3'
(R):5'- AGGTCTCAATACACAAGGGCAC -3'

Sequencing Primer
(F):5'- AGTGTCAACCTGCAGGCTC -3'
(R):5'- CAAGGGCACACTTTAGAATATTCC -3'
Posted On2017-03-31