Mutagenetix > Incidental Mutation

Incidental Mutation 'R0503:Pikfyve'

47230

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

038698-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65219899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 410 (H410L)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: H410L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: H410L

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097707
AA Change: H399L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: H399L

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188799

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190847

Meta Mutation Damage Score

0.1495

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,495	H755R	possibly damaging	Het
Atp2c2	A	G	8: 119,734,577	E279G	probably null	Het
Ccdc65	G	T	15: 98,709,160	D83Y	probably damaging	Het
Cd200r2	T	A	16: 44,877,962	M1K	probably null	Het
Clca4c-ps	A	T	3: 144,879,822		noncoding transcript	Het
Col6a6	A	T	9: 105,767,351	M1246K	probably benign	Het
Comp	A	T	8: 70,375,734	N130I	possibly damaging	Het
Crot	A	G	5: 8,976,075	V304A	possibly damaging	Het
Dapk1	T	A	13: 60,730,848		probably null	Het
Dspp	A	T	5: 104,177,256	D495V	unknown	Het
Erich2	C	A	2: 70,540,775	S426R	unknown	Het
Erich2	A	T	2: 70,509,699	R169S	probably damaging	Het
Gab1	C	T	8: 80,800,142	R109H	probably damaging	Het
Ggcx	GTCTAT	GTCTATCTAT	6: 72,429,157		probably null	Het
Gria1	T	G	11: 57,189,716	V175G	probably damaging	Het
Hmcn1	C	T	1: 150,859,252	V170M	probably damaging	Het
Irx4	T	A	13: 73,266,584		probably null	Het
Katnb1	A	G	8: 95,095,174	T212A	probably damaging	Het
Kirrel	A	G	3: 87,097,802	S80P	probably benign	Het
Lrrc75b	T	C	10: 75,553,654	T81A	possibly damaging	Het
Macf1	A	G	4: 123,469,815	S1775P	probably damaging	Het
Mmp10	A	T	9: 7,507,339	I387F	probably damaging	Het
Mphosph10	A	T	7: 64,389,893	C110S	probably benign	Het
Mpig6b	A	G	17: 35,064,448		probably benign	Het
Mrps27	G	T	13: 99,409,795		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mybpc2	A	G	7: 44,512,570		probably benign	Het
Nbea	C	T	3: 55,642,836	G2724S	possibly damaging	Het
Nck2	A	G	1: 43,533,568	M1V	probably null	Het
Nefl	T	A	14: 68,083,983	D7E	probably benign	Het
Nktr	T	A	9: 121,750,740		probably benign	Het
Nlrp12	C	T	7: 3,249,377	E55K	probably damaging	Het
Nsun7	T	A	5: 66,283,581		probably benign	Het
Olfr1214	C	T	2: 88,987,978	V75I	probably benign	Het
Olfr523	T	C	7: 140,176,441	V113A	possibly damaging	Het
Olfr586	A	T	7: 103,122,436	M112K	possibly damaging	Het
Olfr729	T	A	14: 50,148,478	Y132F	probably damaging	Het
Olfr769	T	C	10: 129,111,802	T208A	probably damaging	Het
Olfr961	A	G	9: 39,647,476	Y250C	probably damaging	Het
Pcdh15	A	G	10: 74,210,385	T165A	probably damaging	Het
Polr3c	A	T	3: 96,713,636		probably null	Het
Ptdss2	T	A	7: 141,151,797		probably benign	Het
Ptprg	A	G	14: 12,237,138	M1386V	possibly damaging	Het
Ptpru	T	C	4: 131,793,643	N784S	probably benign	Het
Rfx4	T	A	10: 84,894,332	I495K	possibly damaging	Het
Serpina12	C	A	12: 104,031,159	A368S	probably damaging	Het
Tmem39b	A	C	4: 129,686,986	Y238D	possibly damaging	Het
Tspan11	T	C	6: 127,939,112	W124R	probably benign	Het
Ttll10	T	C	4: 156,047,548		probably benign	Het
Tyro3	T	C	2: 119,803,230		probably benign	Het
Unc79	A	G	12: 103,078,868	M644V	probably benign	Het
Vmn1r196	G	A	13: 22,293,387	M65I	probably benign	Het
Vmn2r85	T	C	10: 130,422,740	Y482C	probably damaging	Het
Zfp940	A	G	7: 29,846,020		probably benign	Het
Zfyve9	A	T	4: 108,719,764	L40*	probably null	Het
Zkscan1	T	A	5: 138,093,326	I107N	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCATCCCTCTCAAGGGTAACG -3'
(R):5'- AAACTGTGACCCCAATCTGGTTCC -3'

Sequencing Primer
(F):5'- TCCCTCTCAAGGGTAACGAGTAG -3'
(R):5'- GTTCCTTACAGTCTCACCAAATGAAG -3'

Posted On

2013-06-12