Incidental Mutation 'R5948:Sh3tc2'
ID472301
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
MMRRC Submission 043244-MU
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5948 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62013105 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1185 (M1185K)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably damaging
Transcript: ENSMUST00000051720
AA Change: M1185K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: M1185K

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 T C 3: 37,083,355 probably null Het
Adam8 G T 7: 139,987,884 D341E probably benign Het
Ankrd6 T C 4: 32,817,075 T351A possibly damaging Het
Ccdc150 T C 1: 54,277,714 S251P possibly damaging Het
Cfh T C 1: 140,108,808 N629S probably damaging Het
Col4a2 T C 8: 11,420,600 S453P probably benign Het
Csf2 T C 11: 54,247,688 D109G probably benign Het
Dapk1 C A 13: 60,729,395 H483N probably damaging Het
Dnah7c T G 1: 46,672,497 I2628R probably benign Het
Dsp T C 13: 38,195,401 Y2041H possibly damaging Het
Dusp10 A G 1: 184,068,876 N280S probably benign Het
Efhc1 T A 1: 20,972,828 Y324N probably damaging Het
Epsti1 T C 14: 77,939,890 L170P probably damaging Het
Fbn2 C T 18: 58,037,049 G2217R probably damaging Het
Fryl A G 5: 73,097,372 probably null Het
Mrpl39 T C 16: 84,725,153 N244D probably benign Het
Nptxr C T 15: 79,789,841 A445T probably benign Het
Olfr344 A G 2: 36,569,351 Y251C probably damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Parvb G A 15: 84,303,461 V257M probably damaging Het
Piezo1 T C 8: 122,483,347 E2258G probably benign Het
Prpf8 A G 11: 75,509,189 E2303G possibly damaging Het
Psmc6 A G 14: 45,334,657 D88G probably benign Het
Rbbp6 C T 7: 122,997,628 T701I probably damaging Het
Rtl1 T A 12: 109,590,599 D1602V possibly damaging Het
Rubcnl T C 14: 75,047,616 L525P probably damaging Het
Sbf2 T C 7: 110,489,285 D73G probably damaging Het
Shank2 A G 7: 144,407,223 K469E probably damaging Het
Ttc41 T C 10: 86,713,224 L94P probably damaging Het
Ttf1 G A 2: 29,073,920 A603T possibly damaging Het
Usp9y A T Y: 1,324,996 H1686Q possibly damaging Het
Vps37a A G 8: 40,540,711 E249G possibly damaging Het
Zfp273 A G 13: 67,825,799 I316V probably benign Het
Zfp600 T A 4: 146,195,075 N104K probably damaging Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGCCCCTAATCTGTGACATC -3'
(R):5'- GTGGCTGGAAAGTAGCTCTC -3'

Sequencing Primer
(F):5'- GGCCCCTAATCTGTGACATCTAGAG -3'
(R):5'- TGATGATGATGATGATGATGATGATG -3'
Posted On2017-03-31