Incidental Mutation 'R5949:Adcy10'
ID472306
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165539817 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 552 (H552L)
Ref Sequence ENSEMBL: ENSMUSP00000107067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027852
AA Change: H552L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: H552L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111439
AA Change: H552L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: H552L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111440
AA Change: H552L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: H552L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124037
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Arhgap21 A G 2: 20,849,041 S1837P probably damaging Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cdon G A 9: 35,486,951 R988H probably benign Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Mrap2 T G 9: 87,182,605 V133G probably benign Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tfpi T C 2: 84,444,748 E172G probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 intron probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R7988:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACAGCTTCCAGACAGCTCG -3'
(R):5'- ACATTAAGTCACAGAGCTTCAGG -3'

Sequencing Primer
(F):5'- GCTTCCAGACAGCTCGATTAATC -3'
(R):5'- TTTGCAGGAGTCTAATACGAGC -3'
Posted On2017-03-31