Incidental Mutation 'R5949:Arhgap21'
ID472307
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20849041 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1837 (S1837P)
Ref Sequence ENSEMBL: ENSMUSP00000133851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably damaging
Transcript: ENSMUST00000114594
AA Change: S1841P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: S1841P

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136241
Predicted Effect probably damaging
Transcript: ENSMUST00000141298
AA Change: S1847P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: S1847P

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143491
Predicted Effect probably damaging
Transcript: ENSMUST00000154230
AA Change: S1847P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: S1847P

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: S1837P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: S1837P

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174584
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174825
Meta Mutation Damage Score 0.1827 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Adcy10 A T 1: 165,539,817 H552L possibly damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cdon G A 9: 35,486,951 R988H probably benign Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Mrap2 T G 9: 87,182,605 V133G probably benign Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tfpi T C 2: 84,444,748 E172G probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAAGCCAAGGTGCTGGTAG -3'
(R):5'- GCAGATCGTTTAAAACTGAGACC -3'

Sequencing Primer
(F):5'- TGGTAGCAGCAACCCTTG -3'
(R):5'- ACCCGCAGACGACATGTTTG -3'
Posted On2017-03-31