Incidental Mutation 'R5949:Tfpi'
ID472310
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84444748 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 172 (E172G)
Ref Sequence ENSEMBL: ENSMUSP00000107351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000150261]
Predicted Effect probably benign
Transcript: ENSMUST00000028487
AA Change: E172G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090732
AA Change: E172G

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111711
AA Change: E172G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111714
AA Change: E172G

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111717
AA Change: E172G

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111718
AA Change: E172G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111722
AA Change: E172G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082
AA Change: E172G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144775
Predicted Effect probably benign
Transcript: ENSMUST00000150261
AA Change: E165G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082
AA Change: E165G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KU 41 94 4.4e-25 SMART
KU 112 165 7.97e-23 SMART
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Adcy10 A T 1: 165,539,817 H552L possibly damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Arhgap21 A G 2: 20,849,041 S1837P probably damaging Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cdon G A 9: 35,486,951 R988H probably benign Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Mrap2 T G 9: 87,182,605 V133G probably benign Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1069:Tfpi UTSW 2 84453792 splice site probably benign
R1577:Tfpi UTSW 2 84433103 missense probably damaging 0.97
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R2910:Tfpi UTSW 2 84444093 missense possibly damaging 0.93
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R4878:Tfpi UTSW 2 84452555 critical splice donor site probably null
R5810:Tfpi UTSW 2 84434424 intron probably benign
R6899:Tfpi UTSW 2 84444809 missense probably damaging 1.00
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GAGATTCACAGTAACTGTAGAGATGTG -3'
(R):5'- AGAAAGGCCAGATTTCTGCTTC -3'

Sequencing Primer
(F):5'- TTTCTGTTTGTTTGTTTGTTTGTTTG -3'
(R):5'- TTCTTGGAAGAGGACCCTGGAC -3'
Posted On2017-03-31