Mutagenetix > Incidental Mutation

Incidental Mutation 'R5949:Cic'

472323

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

044139-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R5949 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

24967129-24993584 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24971730 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 487 (T487M)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]

AlphaFold

Q924A2

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: T487M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: T487M

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169392

SMART Domains

Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

92% (58/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,655,032 (GRCm39)	Y1452C	probably damaging	Het
Adcy10	A	T	1: 165,367,386 (GRCm39)	H552L	possibly damaging	Het
Alms1-ps1	A	T	6: 85,698,943 (GRCm39)		noncoding transcript	Het
Arhgap21	A	G	2: 20,853,852 (GRCm39)	S1837P	probably damaging	Het
Atad5	G	T	11: 79,986,835 (GRCm39)	E641*	probably null	Het
Atp8b4	T	A	2: 126,247,242 (GRCm39)	T276S	probably benign	Het
Bptf	A	G	11: 107,001,915 (GRCm39)	I399T	probably damaging	Het
Carf	A	C	1: 60,178,472 (GRCm39)	K295T	probably damaging	Het
Cd209d	T	A	8: 3,927,949 (GRCm39)	N52Y	possibly damaging	Het
Cdh2	T	A	18: 16,734,687 (GRCm39)	I779F	probably damaging	Het
Cdon	G	A	9: 35,398,247 (GRCm39)	R988H	probably benign	Het
Cfhr4	A	T	1: 139,660,887 (GRCm39)	H600Q	probably damaging	Het
Dcps	A	G	9: 35,036,557 (GRCm39)		probably benign	Het
Ddx41	A	G	13: 55,679,874 (GRCm39)	C427R	probably damaging	Het
Diras2	T	C	13: 52,661,747 (GRCm39)	K187E	possibly damaging	Het
Emb	A	G	13: 117,403,928 (GRCm39)	I227V	probably benign	Het
Fam193a	T	A	5: 34,597,816 (GRCm39)	S538T	possibly damaging	Het
Fchsd1	C	T	18: 38,092,926 (GRCm39)		probably benign	Het
Galnt6	A	T	15: 100,594,431 (GRCm39)	N533K	probably damaging	Het
Grip1	A	G	10: 119,886,147 (GRCm39)	D499G	probably benign	Het
Ifih1	T	C	2: 62,440,904 (GRCm39)	N421D	probably benign	Het
Ifng	G	C	10: 118,278,529 (GRCm39)	M63I	probably benign	Het
Ighv1-43	A	G	12: 114,910,002 (GRCm39)	M1T	probably null	Het
Kif20a	G	A	18: 34,765,468 (GRCm39)	A822T	probably benign	Het
Krt87	A	T	15: 101,385,476 (GRCm39)	C299S	probably damaging	Het
Lrrn1	G	T	6: 107,544,465 (GRCm39)	V88L	probably benign	Het
Mapkapk2	A	G	1: 130,985,742 (GRCm39)	V173A	possibly damaging	Het
Mrap2	T	G	9: 87,064,658 (GRCm39)	V133G	probably benign	Het
Nlrp1a	T	A	11: 70,989,815 (GRCm39)	D984V	probably damaging	Het
Or4c125	A	G	2: 89,170,229 (GRCm39)	V139A	probably damaging	Het
Or5p59	T	C	7: 107,703,404 (GRCm39)	L296P	probably damaging	Het
Pcdh17	T	C	14: 84,684,996 (GRCm39)	Y488H	probably damaging	Het
Pih1d2	C	T	9: 50,536,284 (GRCm39)	P313L	probably damaging	Het
Ralgapb	T	C	2: 158,296,179 (GRCm39)	C839R	probably damaging	Het
Rdh5	C	A	10: 128,754,136 (GRCm39)	R29L	probably benign	Het
Rfx6	A	G	10: 51,554,429 (GRCm39)	D90G	probably benign	Het
Rnf213	A	G	11: 119,333,905 (GRCm39)	Y3038C	probably damaging	Het
Sec14l2	A	T	11: 4,058,972 (GRCm39)	V191D	probably damaging	Het
Slc3a2	T	C	19: 8,690,759 (GRCm39)	Y118C	probably damaging	Het
Sorbs2	T	C	8: 46,222,934 (GRCm39)		probably null	Het
Stab2	A	G	10: 86,805,713 (GRCm39)	L211P	possibly damaging	Het
Tbc1d9b	T	C	11: 50,038,876 (GRCm39)	C289R	probably benign	Het
Tfpi	T	C	2: 84,275,092 (GRCm39)	E172G	probably benign	Het
Tmem106b	T	A	6: 13,083,418 (GRCm39)	M229K	probably damaging	Het
Tsfm	G	A	10: 126,864,244 (GRCm39)	T157M	probably damaging	Het
Tshr	G	A	12: 91,503,992 (GRCm39)	R310H	probably damaging	Het
Ttn	G	A	2: 76,608,244 (GRCm39)	A17893V	possibly damaging	Het
Vps39	A	G	2: 120,159,149 (GRCm39)	Y380H	probably benign	Het
Xylt2	G	A	11: 94,559,309 (GRCm39)	R383C	probably damaging	Het
Zfp719	C	T	7: 43,233,541 (GRCm39)		probably benign	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	24,991,549 (GRCm39)	missense	probably damaging	1.00
IGL01668:Cic	APN	7	24,990,629 (GRCm39)	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	24,990,375 (GRCm39)	missense	probably damaging	0.96
IGL02506:Cic	APN	7	24,990,282 (GRCm39)	missense	probably benign
IGL02794:Cic	APN	7	24,985,069 (GRCm39)	missense	probably damaging	1.00
IGL03065:Cic	APN	7	24,985,246 (GRCm39)	splice site	probably benign
IGL03304:Cic	APN	7	24,984,274 (GRCm39)	missense	probably damaging	1.00
Capuccino	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
Cassock	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
Monkey	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	24,990,214 (GRCm39)	splice site	probably benign
IGL03046:Cic	UTSW	7	24,990,500 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0027:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0027:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0038:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0038:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0063:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0063:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0064:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0064:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0118:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0241:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0241:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0377:Cic	UTSW	7	24,985,224 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0800:Cic	UTSW	7	24,984,662 (GRCm39)	missense	probably benign
R1253:Cic	UTSW	7	24,990,373 (GRCm39)	missense	probably damaging	1.00
R1458:Cic	UTSW	7	24,979,162 (GRCm39)	intron	probably benign
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1519:Cic	UTSW	7	24,993,235 (GRCm39)	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	24,985,386 (GRCm39)	missense	probably damaging	1.00
R1824:Cic	UTSW	7	24,987,691 (GRCm39)	missense	probably damaging	1.00
R1908:Cic	UTSW	7	24,986,265 (GRCm39)	missense	probably damaging	1.00
R2045:Cic	UTSW	7	24,970,961 (GRCm39)	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	24,972,876 (GRCm39)	missense	probably damaging	0.98
R2161:Cic	UTSW	7	24,987,559 (GRCm39)	splice site	probably null
R2495:Cic	UTSW	7	24,991,201 (GRCm39)	splice site	probably benign
R2865:Cic	UTSW	7	24,972,646 (GRCm39)	missense	probably damaging	0.96
R3692:Cic	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
R3709:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3710:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3872:Cic	UTSW	7	24,971,124 (GRCm39)	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	24,971,771 (GRCm39)	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4426:Cic	UTSW	7	24,993,433 (GRCm39)	utr 3 prime	probably benign
R4502:Cic	UTSW	7	24,987,892 (GRCm39)	missense	probably damaging	1.00
R4585:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4586:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4614:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4664:Cic	UTSW	7	24,990,099 (GRCm39)	small deletion	probably benign
R4688:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4695:Cic	UTSW	7	24,973,013 (GRCm39)	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	24,987,908 (GRCm39)	missense	probably benign
R4746:Cic	UTSW	7	24,987,905 (GRCm39)	missense	probably damaging	1.00
R4758:Cic	UTSW	7	24,991,636 (GRCm39)	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	24,971,025 (GRCm39)	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	24,982,308 (GRCm39)	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	24,971,157 (GRCm39)	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4851:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4922:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R4989:Cic	UTSW	7	24,986,535 (GRCm39)	missense	probably damaging	1.00
R5131:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R5718:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R5801:Cic	UTSW	7	24,970,863 (GRCm39)	missense	possibly damaging	0.93
R6000:Cic	UTSW	7	24,971,423 (GRCm39)	missense	probably benign	0.33
R6246:Cic	UTSW	7	24,971,067 (GRCm39)	missense	probably damaging	1.00
R6283:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R6364:Cic	UTSW	7	24,972,248 (GRCm39)	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	24,987,706 (GRCm39)	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	24,971,202 (GRCm39)	missense	probably benign	0.04
R6920:Cic	UTSW	7	24,990,107 (GRCm39)	missense	probably damaging	1.00
R6995:Cic	UTSW	7	24,970,736 (GRCm39)	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	24,971,621 (GRCm39)	missense	probably damaging	0.99
R7113:Cic	UTSW	7	24,972,869 (GRCm39)	missense	probably benign	0.08
R7560:Cic	UTSW	7	24,972,278 (GRCm39)	missense	probably damaging	0.98
R7680:Cic	UTSW	7	24,991,856 (GRCm39)	missense	probably damaging	0.96
R7698:Cic	UTSW	7	24,972,597 (GRCm39)	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	24,988,207 (GRCm39)	missense	probably damaging	1.00
R7841:Cic	UTSW	7	24,985,192 (GRCm39)	missense	probably damaging	1.00
R7879:Cic	UTSW	7	24,984,551 (GRCm39)	missense	probably benign	0.10
R7916:Cic	UTSW	7	24,987,715 (GRCm39)	missense	probably damaging	0.99
R7920:Cic	UTSW	7	24,971,384 (GRCm39)	missense	probably benign
R8056:Cic	UTSW	7	24,990,366 (GRCm39)	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	24,987,213 (GRCm39)	missense	probably damaging	1.00
R8281:Cic	UTSW	7	24,971,249 (GRCm39)	missense	probably benign
R8847:Cic	UTSW	7	24,970,631 (GRCm39)	missense	probably damaging	0.98
R8991:Cic	UTSW	7	24,988,885 (GRCm39)	missense	probably damaging	1.00
R9083:Cic	UTSW	7	24,985,470 (GRCm39)	missense	probably damaging	0.99
R9140:Cic	UTSW	7	24,985,165 (GRCm39)	missense	probably damaging	0.99
R9200:Cic	UTSW	7	24,971,940 (GRCm39)	missense	probably damaging	0.99
R9208:Cic	UTSW	7	24,987,502 (GRCm39)	missense	probably benign	0.07
R9301:Cic	UTSW	7	24,991,117 (GRCm39)	missense	probably damaging	1.00
R9408:Cic	UTSW	7	24,971,414 (GRCm39)	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	24,972,120 (GRCm39)	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	24,971,403 (GRCm39)	missense	probably damaging	0.96
V7732:Cic	UTSW	7	24,991,670 (GRCm39)	missense	probably benign
Z1176:Cic	UTSW	7	24,970,444 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTTGGTAGCAACCTGGGGAC -3'
(R):5'- CCCAGTCAAACTCAGTGCTTC -3'

Sequencing Primer
(F):5'- AAGTCCCCAGCCTTTGGTG -3'
(R):5'- AAACTCAGTGCTTCCTTCCCGG -3'

Posted On

2017-03-31