Incidental Mutation 'R5949:Cdon'
ID472329
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35486951 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 988 (R988H)
Ref Sequence ENSEMBL: ENSMUSP00000113977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]
Predicted Effect probably benign
Transcript: ENSMUST00000042842
AA Change: R988H

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: R988H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119129
AA Change: R988H

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: R988H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Adcy10 A T 1: 165,539,817 H552L possibly damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Arhgap21 A G 2: 20,849,041 S1837P probably damaging Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Mrap2 T G 9: 87,182,605 V133G probably benign Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tfpi T C 2: 84,444,748 E172G probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAGCTTCCGACTATC -3'
(R):5'- TTGATGCTCCACAGGCTTC -3'

Sequencing Primer
(F):5'- TCCGACTATCCCGTGAAAGAGTTG -3'
(R):5'- GCAGGAATGGTTCTAAAGTCACCTC -3'
Posted On2017-03-31