Incidental Mutation 'R5949:Mrap2'
ID472331
Institutional Source Beutler Lab
Gene Symbol Mrap2
Ensembl Gene ENSMUSG00000042761
Gene Namemelanocortin 2 receptor accessory protein 2
Synonyms
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87144306-87184045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87182605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 133 (V133G)
Ref Sequence ENSEMBL: ENSMUSP00000135904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049457] [ENSMUST00000113149] [ENSMUST00000179313]
Predicted Effect probably benign
Transcript: ENSMUST00000049457
AA Change: V133G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046271
Gene: ENSMUSG00000042761
AA Change: V133G

DomainStartEndE-ValueType
Pfam:MRAP 14 102 6.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113149
AA Change: V133G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108774
Gene: ENSMUSG00000042761
AA Change: V133G

DomainStartEndE-ValueType
Pfam:MRAP 14 102 6.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179313
AA Change: V133G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135904
Gene: ENSMUSG00000042761
AA Change: V133G

DomainStartEndE-ValueType
Pfam:MRAP 15 101 4.5e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that modulates melanocortin receptor signaling. The encoded protein has been shown to interact with all known melanocortin receptors and may regulate both receptor trafficking and activation in response to ligands. Mice lacking a functional copy of this gene exhibit severe obesity and a mutation in this gene may be associated with severe obesity in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe obesity at a young age. Obesity develops early during ad libitum feeding before the onset of hyperphagia, persists in mutant mice pair-fed to a normal dietary intake, and is abolished only by underfeeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Adcy10 A T 1: 165,539,817 H552L possibly damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Arhgap21 A G 2: 20,849,041 S1837P probably damaging Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cdon G A 9: 35,486,951 R988H probably benign Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tfpi T C 2: 84,444,748 E172G probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Tshr G A 12: 91,537,218 R310H probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Mrap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0790:Mrap2 UTSW 9 87182782 missense possibly damaging 0.74
R4598:Mrap2 UTSW 9 87182789 missense probably damaging 1.00
R5118:Mrap2 UTSW 9 87182703 missense possibly damaging 0.82
R6144:Mrap2 UTSW 9 87175818 missense probably damaging 1.00
R6925:Mrap2 UTSW 9 87182474 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTTCTTTACAGCAACGCGGAG -3'
(R):5'- AGTCCAGGTCTATGCGTGATG -3'

Sequencing Primer
(F):5'- TTACAGCAACGCGGAGTCCTC -3'
(R):5'- TCTAGAAGAACGGGTGCTTCC -3'
Posted On2017-03-31