Incidental Mutation 'R0503:Olfr1214'
ID47234
Institutional Source Beutler Lab
Gene Symbol Olfr1214
Ensembl Gene ENSMUSG00000075110
Gene Nameolfactory receptor 1214
SynonymsGA_x6K02T2Q125-50468705-50467770, MOR233-8
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88986479-88992653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88987978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 75 (V75I)
Ref Sequence ENSEMBL: ENSMUSP00000150322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099804] [ENSMUST00000216026] [ENSMUST00000217469]
Predicted Effect probably benign
Transcript: ENSMUST00000099804
AA Change: V75I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097392
Gene: ENSMUSG00000075110
AA Change: V75I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 286 4.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216026
AA Change: V75I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000217469
AA Change: V75I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Olfr1214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Olfr1214 APN 2 88988080 missense probably benign 0.00
IGL03409:Olfr1214 APN 2 88987587 missense possibly damaging 0.93
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0688:Olfr1214 UTSW 2 88987595 missense probably damaging 1.00
R1120:Olfr1214 UTSW 2 88988079 missense possibly damaging 0.51
R1752:Olfr1214 UTSW 2 88987315 missense possibly damaging 0.60
R2018:Olfr1214 UTSW 2 88988145 missense probably benign 0.06
R2281:Olfr1214 UTSW 2 88987470 missense probably benign 0.03
R2509:Olfr1214 UTSW 2 88987431 missense probably damaging 1.00
R2862:Olfr1214 UTSW 2 88987320 missense probably benign
R3942:Olfr1214 UTSW 2 88988111 missense probably benign 0.15
R4894:Olfr1214 UTSW 2 88987439 missense possibly damaging 0.83
R4899:Olfr1214 UTSW 2 88988110 missense probably null 0.13
R5089:Olfr1214 UTSW 2 88988172 missense probably damaging 1.00
R5253:Olfr1214 UTSW 2 88988100 missense possibly damaging 0.67
R5338:Olfr1214 UTSW 2 88987465 missense possibly damaging 0.87
R6476:Olfr1214 UTSW 2 88987377 missense probably benign 0.06
Z1177:Olfr1214 UTSW 2 88987881 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTTGCAAATAGCCACATAGCGGTC -3'
(R):5'- GCCCTGCCTAGTTCCATGAAGATG -3'

Sequencing Primer
(F):5'- TAGCCACATAGCGGTCATAGG -3'
(R):5'- GCATAACCAGAGCTATGTCAATG -3'
Posted On2013-06-12