Incidental Mutation 'R5949:Tshr'
ID472345
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Namethyroid stimulating hormone receptor
Synonymspet, hyt, hypothroid
MMRRC Submission 044139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5949 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location91384563-91549808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91537218 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 310 (R310H)
Ref Sequence ENSEMBL: ENSMUSP00000021346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]
Predicted Effect probably damaging
Transcript: ENSMUST00000021346
AA Change: R310H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: R310H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186437
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221216
Meta Mutation Damage Score 0.2098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,678,073 Y1452C probably damaging Het
Adcy10 A T 1: 165,539,817 H552L possibly damaging Het
Alms1-ps1 A T 6: 85,721,961 noncoding transcript Het
Arhgap21 A G 2: 20,849,041 S1837P probably damaging Het
Atad5 G T 11: 80,096,009 E641* probably null Het
Atp8b4 T A 2: 126,405,322 T276S probably benign Het
Bptf A G 11: 107,111,089 I399T probably damaging Het
Carf A C 1: 60,139,313 K295T probably damaging Het
Cd209d T A 8: 3,877,949 N52Y possibly damaging Het
Cdh2 T A 18: 16,601,630 I779F probably damaging Het
Cdon G A 9: 35,486,951 R988H probably benign Het
Cic C T 7: 25,272,305 T487M probably damaging Het
Dcps A G 9: 35,125,261 probably benign Het
Ddx41 A G 13: 55,532,061 C427R probably damaging Het
Diras2 T C 13: 52,507,711 K187E possibly damaging Het
Emb A G 13: 117,267,392 I227V probably benign Het
Fam193a T A 5: 34,440,472 S538T possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Galnt6 A T 15: 100,696,550 N533K probably damaging Het
Gm4788 A T 1: 139,733,149 H600Q probably damaging Het
Grip1 A G 10: 120,050,242 D499G probably benign Het
Ifih1 T C 2: 62,610,560 N421D probably benign Het
Ifng G C 10: 118,442,624 M63I probably benign Het
Ighv1-43 A G 12: 114,946,382 M1T probably null Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt83 A T 15: 101,487,595 C299S probably damaging Het
Lrrn1 G T 6: 107,567,504 V88L probably benign Het
Mapkapk2 A G 1: 131,058,005 V173A possibly damaging Het
Mrap2 T G 9: 87,182,605 V133G probably benign Het
Nlrp1a T A 11: 71,098,989 D984V probably damaging Het
Olfr1233 A G 2: 89,339,885 V139A probably damaging Het
Olfr483 T C 7: 108,104,197 L296P probably damaging Het
Pcdh17 T C 14: 84,447,556 Y488H probably damaging Het
Pih1d2 C T 9: 50,624,984 P313L probably damaging Het
Ralgapb T C 2: 158,454,259 C839R probably damaging Het
Rdh5 C A 10: 128,918,267 R29L probably benign Het
Rfx6 A G 10: 51,678,333 D90G probably benign Het
Rnf213 A G 11: 119,443,079 Y3038C probably damaging Het
Sec14l2 A T 11: 4,108,972 V191D probably damaging Het
Slc3a2 T C 19: 8,713,395 Y118C probably damaging Het
Sorbs2 T C 8: 45,769,897 probably null Het
Stab2 A G 10: 86,969,849 L211P possibly damaging Het
Tbc1d9b T C 11: 50,148,049 C289R probably benign Het
Tfpi T C 2: 84,444,748 E172G probably benign Het
Tmem106b T A 6: 13,083,419 M229K probably damaging Het
Tsfm G A 10: 127,028,375 T157M probably damaging Het
Ttn G A 2: 76,777,900 A17893V possibly damaging Het
Vps39 A G 2: 120,328,668 Y380H probably benign Het
Xylt2 G A 11: 94,668,483 R383C probably damaging Het
Zfp719 C T 7: 43,584,117 probably benign Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
R7691:Tshr UTSW 12 91497741 missense probably benign 0.00
R7741:Tshr UTSW 12 91533969 nonsense probably null
R7769:Tshr UTSW 12 91538270 missense probably damaging 1.00
R7784:Tshr UTSW 12 91505305 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAGACCCTGCAGAATTCATC -3'
(R):5'- AGTCATAGTGGCTCTCGAAGG -3'

Sequencing Primer
(F):5'- CTGCAGAATTCATCACACCATG -3'
(R):5'- TTGAGCTCTTGGCCGAAAC -3'
Posted On2017-03-31