Incidental Mutation 'R5950:Pard3b'
ID472359
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 044140-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5950 (G1)
Quality Score207
Status Validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62216531 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 572 (Y572N)
Ref Sequence ENSEMBL: ENSMUSP00000040439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
Predicted Effect probably benign
Transcript: ENSMUST00000046673
AA Change: Y572N

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: Y572N

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075374
AA Change: Y634N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: Y634N

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094906
AA Change: Y634N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: Y634N

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Abca15 G A 7: 120,382,656 G1065R probably damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Cntnap3 G A 13: 64,787,769 L427F probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkd2l1 A C 19: 44,152,090 V608G probably benign Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tank A G 2: 61,653,569 probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zc3h6 C A 2: 128,997,790 Y174* probably null Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
R8329:Pard3b UTSW 1 62637798 missense probably benign 0.30
R8766:Pard3b UTSW 1 62159478 missense probably benign 0.35
R8833:Pard3b UTSW 1 62344999 missense probably benign 0.00
R8889:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8892:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8907:Pard3b UTSW 1 62344135 missense probably benign 0.39
R8909:Pard3b UTSW 1 62344135 missense probably benign 0.39
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGACCAGTCTTGCACTCAG -3'
(R):5'- CAGTGCTCATGACTCTGAGTG -3'

Sequencing Primer
(F):5'- AGTCTTGCACTCAGCTTTGG -3'
(R):5'- GCTCATGACTCTGAGTGACAAAGTC -3'
Posted On2017-03-31