Mutagenetix > Incidental Mutation

Incidental Mutation 'R5950:Atf6'

472363

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

044140-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 170834879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 271 (G271R)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: G271R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: G271R

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179933

Meta Mutation Damage Score

0.0788

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

93% (75/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	A	17: 28,905,755	Q256L	possibly damaging	Het
Abca15	G	A	7: 120,382,656	G1065R	probably damaging	Het
Acox2	A	T	14: 8,255,793	Y113N	probably benign	Het
Arid4b	T	A	13: 14,191,264		probably benign	Het
Cct8l1	C	A	5: 25,517,743	F485L	probably benign	Het
Cdk5r2	A	G	1: 74,855,402	E102G	probably damaging	Het
Celsr1	A	T	15: 86,032,500	V424E	probably damaging	Het
Ces1h	T	C	8: 93,362,959	T271A	probably benign	Het
Cfap44	T	C	16: 44,479,847	I1738T	probably damaging	Het
Cntnap3	G	A	13: 64,787,769	L427F	probably damaging	Het
Crybg3	T	C	16: 59,493,571		probably benign	Het
Dis3l2	A	G	1: 87,021,108	D589G	probably damaging	Het
Dlg1	A	G	16: 31,665,583	R10G	probably damaging	Het
Dnajc1	A	C	2: 18,306,941		probably benign	Het
Dpy19l2	T	A	9: 24,581,134	T723S	probably benign	Het
Dsg3	A	T	18: 20,538,529	N764Y	probably damaging	Het
Dst	G	T	1: 34,262,060	R3654L	probably damaging	Het
Evl	C	T	12: 108,675,553	T198I	probably benign	Het
Hectd2	A	G	19: 36,597,239		probably benign	Het
Hsp90b1	A	G	10: 86,701,745	V232A	possibly damaging	Het
Igsf5	T	C	16: 96,372,872	V34A	probably benign	Het
Ikzf2	A	T	1: 69,683,244	N41K	probably damaging	Het
Kif6	G	T	17: 49,715,088	A339S	probably damaging	Het
Klhl1	T	A	14: 96,240,354	D426V	probably damaging	Het
Knop1	A	C	7: 118,853,334	V54G	probably damaging	Het
Lama4	T	A	10: 39,030,448	V270D	probably benign	Het
Lnx2	A	G	5: 147,024,350		probably null	Het
Lrp5	A	T	19: 3,602,333	V1179E	probably benign	Het
Lrpprc	T	G	17: 84,740,170	D878A	possibly damaging	Het
Lrrc14	A	T	15: 76,715,310		probably benign	Het
Ltbp1	A	T	17: 75,273,870	D660V	probably damaging	Het
Macf1	C	G	4: 123,439,436		probably null	Het
Map3k21	C	A	8: 125,941,760	T695K	possibly damaging	Het
Mcm3ap	T	A	10: 76,488,419	D895E	possibly damaging	Het
Mfsd7a	A	T	5: 108,445,485	H162Q	probably damaging	Het
Mink1	T	A	11: 70,609,586	D779E	possibly damaging	Het
Mkrn3	T	C	7: 62,419,719	E108G	probably damaging	Het
Nars	A	G	18: 64,510,485	V141A	possibly damaging	Het
Olfr954	T	C	9: 39,462,337	V299A	probably benign	Het
Pard3b	T	A	1: 62,216,531	Y572N	probably benign	Het
Pcnx3	A	C	19: 5,667,158	M1599R	possibly damaging	Het
Pitx2	A	G	3: 129,218,520	S180G	probably damaging	Het
Pkd2l1	A	C	19: 44,152,090	V608G	probably benign	Het
Pkhd1l1	A	G	15: 44,532,965	D1961G	probably benign	Het
Pxylp1	T	C	9: 96,839,126	T109A	probably damaging	Het
Rai1	T	A	11: 60,187,593	C828S	probably damaging	Het
Ralgapa1	T	A	12: 55,738,265	T737S	possibly damaging	Het
Scn11a	A	G	9: 119,811,124	V235A	probably damaging	Het
Sfxn1	A	T	13: 54,091,287	T134S	probably benign	Het
Skint1	A	G	4: 112,019,335	Y151C	probably benign	Het
Slc11a1	G	T	1: 74,377,176	W54L	probably benign	Het
Soga3	T	C	10: 29,143,648		probably benign	Het
Synpo2l	T	A	14: 20,665,935	Q191L	probably benign	Het
Tank	A	G	2: 61,653,569		probably benign	Het
Tctex1d1	T	G	4: 103,004,250	L147R	probably damaging	Het
Terb1	A	T	8: 104,488,485		probably null	Het
Trdc	T	C	14: 54,144,311		probably benign	Het
Tsen34	A	G	7: 3,694,788	I63V	probably null	Het
Ust	T	C	10: 8,248,101	H257R	probably benign	Het
Vmn2r6	T	C	3: 64,565,231	Q23R	probably benign	Het
Wdr93	A	T	7: 79,773,431	H481L	probably damaging	Het
Xirp2	A	G	2: 67,511,320	T1302A	possibly damaging	Het
Zc3h6	C	A	2: 128,997,790	Y174*	probably null	Het
Zcchc7	T	G	4: 44,931,244	D144E	possibly damaging	Het
Zfp472	T	A	17: 32,977,507	H185Q	possibly damaging	Het
Zfp523	C	A	17: 28,202,558	P66H	probably benign	Het
Zfp712	A	T	13: 67,044,817	L57Q	probably damaging	Het
Zik1	G	A	7: 10,490,571	Q200*	probably null	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAAATGTGCAATTTTGGCACAC -3'
(R):5'- AAACAGAGCTGGATGTTCGG -3'

Sequencing Primer
(F):5'- ATGTGCAATTTTGGCACACTCTTAC -3'
(R):5'- GCTCCCTTACAGAGTTACACACTG -3'

Posted On

2017-03-31