Incidental Mutation 'R5950:Tank'
ID472365
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission 044140-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R5950 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 61653569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect probably benign
Transcript: ENSMUST00000078074
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112494
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112495
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112501
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112502
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154693
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Abca15 G A 7: 120,382,656 G1065R probably damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Cntnap3 G A 13: 64,787,769 L427F probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pard3b T A 1: 62,216,531 Y572N probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkd2l1 A C 19: 44,152,090 V608G probably benign Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zc3h6 C A 2: 128,997,790 Y174* probably null Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
R7478:Tank UTSW 2 61650169 missense probably damaging 1.00
R8293:Tank UTSW 2 61644414 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCCTTTTCTTAACCAAGACACTG -3'
(R):5'- CTGGGCAACTAATGATTGATTCGAC -3'

Sequencing Primer
(F):5'- ACTGACTTAGTGGTACCAAGTG -3'
(R):5'- CTGAATAACTCTGTAAGTCACATGTG -3'
Posted On2017-03-31