Incidental Mutation 'R5950:Wdr93'
ID 472383
Institutional Source Beutler Lab
Gene Symbol Wdr93
Ensembl Gene ENSMUSG00000039099
Gene Name WD repeat domain 93
Synonyms EG626359
MMRRC Submission 044140-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R5950 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79392911-79435698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79423179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 481 (H481L)
Ref Sequence ENSEMBL: ENSMUSP00000037467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035622]
AlphaFold Q402B2
Predicted Effect probably damaging
Transcript: ENSMUST00000035622
AA Change: H481L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037467
Gene: ENSMUSG00000039099
AA Change: H481L

DomainStartEndE-ValueType
low complexity region 240 251 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
SCOP:d1jofa_ 389 607 7e-4 SMART
Blast:WD40 413 451 2e-11 BLAST
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 119,981,879 (GRCm39) G1065R probably damaging Het
Acox2 A T 14: 8,255,793 (GRCm38) Y113N probably benign Het
Arid4b T A 13: 14,365,849 (GRCm39) probably benign Het
Atf6 C T 1: 170,662,448 (GRCm39) G271R probably damaging Het
Bnip5 T A 17: 29,124,729 (GRCm39) Q256L possibly damaging Het
Cct8l1 C A 5: 25,722,741 (GRCm39) F485L probably benign Het
Cdk5r2 A G 1: 74,894,561 (GRCm39) E102G probably damaging Het
Celsr1 A T 15: 85,916,701 (GRCm39) V424E probably damaging Het
Ces1h T C 8: 94,089,587 (GRCm39) T271A probably benign Het
Cfap44 T C 16: 44,300,210 (GRCm39) I1738T probably damaging Het
Cntnap3 G A 13: 64,935,583 (GRCm39) L427F probably damaging Het
Crybg3 T C 16: 59,313,934 (GRCm39) probably benign Het
Dis3l2 A G 1: 86,948,830 (GRCm39) D589G probably damaging Het
Dlg1 A G 16: 31,484,401 (GRCm39) R10G probably damaging Het
Dnajc1 A C 2: 18,311,752 (GRCm39) probably benign Het
Dpy19l2 T A 9: 24,492,430 (GRCm39) T723S probably benign Het
Dsg3 A T 18: 20,671,586 (GRCm39) N764Y probably damaging Het
Dst G T 1: 34,301,141 (GRCm39) R3654L probably damaging Het
Dynlt5 T G 4: 102,861,447 (GRCm39) L147R probably damaging Het
Evl C T 12: 108,641,812 (GRCm39) T198I probably benign Het
Hectd2 A G 19: 36,574,639 (GRCm39) probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Igsf5 T C 16: 96,174,072 (GRCm39) V34A probably benign Het
Ikzf2 A T 1: 69,722,403 (GRCm39) N41K probably damaging Het
Kif6 G T 17: 50,022,116 (GRCm39) A339S probably damaging Het
Klhl1 T A 14: 96,477,790 (GRCm39) D426V probably damaging Het
Knop1 A C 7: 118,452,557 (GRCm39) V54G probably damaging Het
Lama4 T A 10: 38,906,444 (GRCm39) V270D probably benign Het
Lnx2 A G 5: 146,961,160 (GRCm39) probably null Het
Lrp5 A T 19: 3,652,333 (GRCm39) V1179E probably benign Het
Lrpprc T G 17: 85,047,598 (GRCm39) D878A possibly damaging Het
Lrrc14 A T 15: 76,599,510 (GRCm39) probably benign Het
Ltbp1 A T 17: 75,580,865 (GRCm39) D660V probably damaging Het
Macf1 C G 4: 123,333,229 (GRCm39) probably null Het
Map3k21 C A 8: 126,668,499 (GRCm39) T695K possibly damaging Het
Mcm3ap T A 10: 76,324,253 (GRCm39) D895E possibly damaging Het
Mink1 T A 11: 70,500,412 (GRCm39) D779E possibly damaging Het
Mkrn3 T C 7: 62,069,467 (GRCm39) E108G probably damaging Het
Mtcl3 T C 10: 29,019,644 (GRCm39) probably benign Het
Nars1 A G 18: 64,643,556 (GRCm39) V141A possibly damaging Het
Or8g34 T C 9: 39,373,633 (GRCm39) V299A probably benign Het
Pard3b T A 1: 62,255,690 (GRCm39) Y572N probably benign Het
Pcnx3 A C 19: 5,717,186 (GRCm39) M1599R possibly damaging Het
Pitx2 A G 3: 129,012,169 (GRCm39) S180G probably damaging Het
Pkd2l1 A C 19: 44,140,529 (GRCm39) V608G probably benign Het
Pkhd1l1 A G 15: 44,396,361 (GRCm39) D1961G probably benign Het
Pxylp1 T C 9: 96,721,179 (GRCm39) T109A probably damaging Het
Rai1 T A 11: 60,078,419 (GRCm39) C828S probably damaging Het
Ralgapa1 T A 12: 55,785,050 (GRCm39) T737S possibly damaging Het
Scn11a A G 9: 119,640,190 (GRCm39) V235A probably damaging Het
Sfxn1 A T 13: 54,245,306 (GRCm39) T134S probably benign Het
Skint1 A G 4: 111,876,532 (GRCm39) Y151C probably benign Het
Slc11a1 G T 1: 74,416,335 (GRCm39) W54L probably benign Het
Slc49a3 A T 5: 108,593,351 (GRCm39) H162Q probably damaging Het
Synpo2l T A 14: 20,716,003 (GRCm39) Q191L probably benign Het
Tank A G 2: 61,483,913 (GRCm39) probably benign Het
Terb1 A T 8: 105,215,117 (GRCm39) probably null Het
Trdc T C 14: 54,381,768 (GRCm39) probably benign Het
Tsen34 A G 7: 3,697,787 (GRCm39) I63V probably null Het
Ust T C 10: 8,123,865 (GRCm39) H257R probably benign Het
Vmn2r6 T C 3: 64,472,652 (GRCm39) Q23R probably benign Het
Xirp2 A G 2: 67,341,664 (GRCm39) T1302A possibly damaging Het
Zc3h6 C A 2: 128,839,710 (GRCm39) Y174* probably null Het
Zcchc7 T G 4: 44,931,244 (GRCm39) D144E possibly damaging Het
Zfp472 T A 17: 33,196,481 (GRCm39) H185Q possibly damaging Het
Zfp523 C A 17: 28,421,532 (GRCm39) P66H probably benign Het
Zfp712 A T 13: 67,192,881 (GRCm39) L57Q probably damaging Het
Zik1 G A 7: 10,224,498 (GRCm39) Q200* probably null Het
Other mutations in Wdr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Wdr93 APN 7 79,425,301 (GRCm39) missense probably damaging 1.00
IGL01910:Wdr93 APN 7 79,421,321 (GRCm39) missense probably damaging 1.00
IGL01977:Wdr93 APN 7 79,402,253 (GRCm39) missense probably damaging 1.00
IGL01979:Wdr93 APN 7 79,426,400 (GRCm39) missense probably benign 0.03
IGL02191:Wdr93 APN 7 79,398,968 (GRCm39) missense probably damaging 0.98
R0008:Wdr93 UTSW 7 79,408,221 (GRCm39) missense probably damaging 1.00
R0008:Wdr93 UTSW 7 79,408,221 (GRCm39) missense probably damaging 1.00
R1136:Wdr93 UTSW 7 79,423,196 (GRCm39) missense probably damaging 1.00
R1168:Wdr93 UTSW 7 79,398,922 (GRCm39) missense probably damaging 0.99
R1586:Wdr93 UTSW 7 79,418,109 (GRCm39) missense probably damaging 0.99
R1605:Wdr93 UTSW 7 79,421,257 (GRCm39) splice site probably null
R1651:Wdr93 UTSW 7 79,399,830 (GRCm39) missense probably benign 0.00
R3078:Wdr93 UTSW 7 79,402,241 (GRCm39) missense possibly damaging 0.81
R3689:Wdr93 UTSW 7 79,421,333 (GRCm39) missense possibly damaging 0.91
R4013:Wdr93 UTSW 7 79,418,159 (GRCm39) missense possibly damaging 0.90
R4771:Wdr93 UTSW 7 79,426,511 (GRCm39) missense probably damaging 0.99
R4824:Wdr93 UTSW 7 79,399,817 (GRCm39) nonsense probably null
R4887:Wdr93 UTSW 7 79,435,522 (GRCm39) missense probably damaging 1.00
R5172:Wdr93 UTSW 7 79,402,241 (GRCm39) missense probably damaging 0.97
R5510:Wdr93 UTSW 7 79,399,779 (GRCm39) missense probably damaging 1.00
R5625:Wdr93 UTSW 7 79,420,766 (GRCm39) missense probably benign 0.00
R5648:Wdr93 UTSW 7 79,426,974 (GRCm39) missense probably benign 0.04
R6147:Wdr93 UTSW 7 79,408,245 (GRCm39) missense probably benign
R6530:Wdr93 UTSW 7 79,405,741 (GRCm39) missense probably damaging 1.00
R7056:Wdr93 UTSW 7 79,399,088 (GRCm39) missense probably damaging 1.00
R7079:Wdr93 UTSW 7 79,399,040 (GRCm39) missense probably damaging 1.00
R7309:Wdr93 UTSW 7 79,423,103 (GRCm39) missense possibly damaging 0.86
R7397:Wdr93 UTSW 7 79,416,172 (GRCm39) missense probably null 0.01
R7426:Wdr93 UTSW 7 79,427,055 (GRCm39) critical splice donor site probably null
R7455:Wdr93 UTSW 7 79,425,267 (GRCm39) missense probably benign 0.09
R7618:Wdr93 UTSW 7 79,435,474 (GRCm39) missense probably benign 0.02
R8360:Wdr93 UTSW 7 79,398,974 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACGCTTCTCTAGGCACGAG -3'
(R):5'- TGGCAGATTATCACCTTTGTCCTG -3'

Sequencing Primer
(F):5'- ATGAGCATCCCCCTTGCAGATG -3'
(R):5'- GTCCCTAAGCCACTGACCTG -3'
Posted On 2017-03-31