Incidental Mutation 'R5950:Or8g34'
ID 472390
Institutional Source Beutler Lab
Gene Symbol Or8g34
Ensembl Gene ENSMUSG00000094745
Gene Name olfactory receptor family 8 subfamily G member 34
Synonyms GA_x6K02T2PVTD-33158015-33158950, MOR171-42, Olfr954, MOR171-53
MMRRC Submission 044140-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5950 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39372729-39373673 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39373633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 299 (V299A)
Ref Sequence ENSEMBL: ENSMUSP00000151116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
AlphaFold Q9EQB6
Predicted Effect probably benign
Transcript: ENSMUST00000080329
AA Change: V302A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: V302A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: V299A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 119,981,879 (GRCm39) G1065R probably damaging Het
Acox2 A T 14: 8,255,793 (GRCm38) Y113N probably benign Het
Arid4b T A 13: 14,365,849 (GRCm39) probably benign Het
Atf6 C T 1: 170,662,448 (GRCm39) G271R probably damaging Het
Bnip5 T A 17: 29,124,729 (GRCm39) Q256L possibly damaging Het
Cct8l1 C A 5: 25,722,741 (GRCm39) F485L probably benign Het
Cdk5r2 A G 1: 74,894,561 (GRCm39) E102G probably damaging Het
Celsr1 A T 15: 85,916,701 (GRCm39) V424E probably damaging Het
Ces1h T C 8: 94,089,587 (GRCm39) T271A probably benign Het
Cfap44 T C 16: 44,300,210 (GRCm39) I1738T probably damaging Het
Cntnap3 G A 13: 64,935,583 (GRCm39) L427F probably damaging Het
Crybg3 T C 16: 59,313,934 (GRCm39) probably benign Het
Dis3l2 A G 1: 86,948,830 (GRCm39) D589G probably damaging Het
Dlg1 A G 16: 31,484,401 (GRCm39) R10G probably damaging Het
Dnajc1 A C 2: 18,311,752 (GRCm39) probably benign Het
Dpy19l2 T A 9: 24,492,430 (GRCm39) T723S probably benign Het
Dsg3 A T 18: 20,671,586 (GRCm39) N764Y probably damaging Het
Dst G T 1: 34,301,141 (GRCm39) R3654L probably damaging Het
Dynlt5 T G 4: 102,861,447 (GRCm39) L147R probably damaging Het
Evl C T 12: 108,641,812 (GRCm39) T198I probably benign Het
Hectd2 A G 19: 36,574,639 (GRCm39) probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Igsf5 T C 16: 96,174,072 (GRCm39) V34A probably benign Het
Ikzf2 A T 1: 69,722,403 (GRCm39) N41K probably damaging Het
Kif6 G T 17: 50,022,116 (GRCm39) A339S probably damaging Het
Klhl1 T A 14: 96,477,790 (GRCm39) D426V probably damaging Het
Knop1 A C 7: 118,452,557 (GRCm39) V54G probably damaging Het
Lama4 T A 10: 38,906,444 (GRCm39) V270D probably benign Het
Lnx2 A G 5: 146,961,160 (GRCm39) probably null Het
Lrp5 A T 19: 3,652,333 (GRCm39) V1179E probably benign Het
Lrpprc T G 17: 85,047,598 (GRCm39) D878A possibly damaging Het
Lrrc14 A T 15: 76,599,510 (GRCm39) probably benign Het
Ltbp1 A T 17: 75,580,865 (GRCm39) D660V probably damaging Het
Macf1 C G 4: 123,333,229 (GRCm39) probably null Het
Map3k21 C A 8: 126,668,499 (GRCm39) T695K possibly damaging Het
Mcm3ap T A 10: 76,324,253 (GRCm39) D895E possibly damaging Het
Mink1 T A 11: 70,500,412 (GRCm39) D779E possibly damaging Het
Mkrn3 T C 7: 62,069,467 (GRCm39) E108G probably damaging Het
Mtcl3 T C 10: 29,019,644 (GRCm39) probably benign Het
Nars1 A G 18: 64,643,556 (GRCm39) V141A possibly damaging Het
Pard3b T A 1: 62,255,690 (GRCm39) Y572N probably benign Het
Pcnx3 A C 19: 5,717,186 (GRCm39) M1599R possibly damaging Het
Pitx2 A G 3: 129,012,169 (GRCm39) S180G probably damaging Het
Pkd2l1 A C 19: 44,140,529 (GRCm39) V608G probably benign Het
Pkhd1l1 A G 15: 44,396,361 (GRCm39) D1961G probably benign Het
Pxylp1 T C 9: 96,721,179 (GRCm39) T109A probably damaging Het
Rai1 T A 11: 60,078,419 (GRCm39) C828S probably damaging Het
Ralgapa1 T A 12: 55,785,050 (GRCm39) T737S possibly damaging Het
Scn11a A G 9: 119,640,190 (GRCm39) V235A probably damaging Het
Sfxn1 A T 13: 54,245,306 (GRCm39) T134S probably benign Het
Skint1 A G 4: 111,876,532 (GRCm39) Y151C probably benign Het
Slc11a1 G T 1: 74,416,335 (GRCm39) W54L probably benign Het
Slc49a3 A T 5: 108,593,351 (GRCm39) H162Q probably damaging Het
Synpo2l T A 14: 20,716,003 (GRCm39) Q191L probably benign Het
Tank A G 2: 61,483,913 (GRCm39) probably benign Het
Terb1 A T 8: 105,215,117 (GRCm39) probably null Het
Trdc T C 14: 54,381,768 (GRCm39) probably benign Het
Tsen34 A G 7: 3,697,787 (GRCm39) I63V probably null Het
Ust T C 10: 8,123,865 (GRCm39) H257R probably benign Het
Vmn2r6 T C 3: 64,472,652 (GRCm39) Q23R probably benign Het
Wdr93 A T 7: 79,423,179 (GRCm39) H481L probably damaging Het
Xirp2 A G 2: 67,341,664 (GRCm39) T1302A possibly damaging Het
Zc3h6 C A 2: 128,839,710 (GRCm39) Y174* probably null Het
Zcchc7 T G 4: 44,931,244 (GRCm39) D144E possibly damaging Het
Zfp472 T A 17: 33,196,481 (GRCm39) H185Q possibly damaging Het
Zfp523 C A 17: 28,421,532 (GRCm39) P66H probably benign Het
Zfp712 A T 13: 67,192,881 (GRCm39) L57Q probably damaging Het
Zik1 G A 7: 10,224,498 (GRCm39) Q200* probably null Het
Other mutations in Or8g34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Or8g34 APN 9 39,373,579 (GRCm39) missense probably damaging 0.98
IGL02793:Or8g34 APN 9 39,372,802 (GRCm39) missense probably benign 0.09
IGL02964:Or8g34 APN 9 39,373,077 (GRCm39) missense possibly damaging 0.88
IGL02979:Or8g34 APN 9 39,372,819 (GRCm39) missense probably benign 0.02
R0041:Or8g34 UTSW 9 39,372,772 (GRCm39) missense probably benign 0.34
R0153:Or8g34 UTSW 9 39,372,967 (GRCm39) missense probably damaging 0.99
R0269:Or8g34 UTSW 9 39,373,090 (GRCm39) missense probably damaging 1.00
R0426:Or8g34 UTSW 9 39,372,889 (GRCm39) missense probably damaging 1.00
R0731:Or8g34 UTSW 9 39,372,828 (GRCm39) missense probably damaging 1.00
R1800:Or8g34 UTSW 9 39,373,410 (GRCm39) missense probably damaging 1.00
R2340:Or8g34 UTSW 9 39,373,105 (GRCm39) missense probably damaging 1.00
R2901:Or8g34 UTSW 9 39,373,234 (GRCm39) missense probably damaging 0.97
R2912:Or8g34 UTSW 9 39,373,512 (GRCm39) missense probably damaging 1.00
R2939:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R2940:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R3081:Or8g34 UTSW 9 39,373,226 (GRCm39) missense probably benign 0.02
R3765:Or8g34 UTSW 9 39,372,920 (GRCm39) nonsense probably null
R4450:Or8g34 UTSW 9 39,373,328 (GRCm39) missense probably benign 0.00
R4515:Or8g34 UTSW 9 39,373,527 (GRCm39) nonsense probably null
R4786:Or8g34 UTSW 9 39,373,137 (GRCm39) missense probably benign 0.16
R4961:Or8g34 UTSW 9 39,373,183 (GRCm39) missense probably damaging 1.00
R5219:Or8g34 UTSW 9 39,373,563 (GRCm39) missense probably benign 0.09
R5602:Or8g34 UTSW 9 39,373,326 (GRCm39) missense probably benign 0.00
R5887:Or8g34 UTSW 9 39,372,787 (GRCm39) missense probably damaging 1.00
R6943:Or8g34 UTSW 9 39,373,159 (GRCm39) missense probably benign 0.05
R7567:Or8g34 UTSW 9 39,373,173 (GRCm39) missense possibly damaging 0.92
R8817:Or8g34 UTSW 9 39,373,387 (GRCm39) missense probably damaging 1.00
R9251:Or8g34 UTSW 9 39,373,668 (GRCm39) missense probably benign
X0060:Or8g34 UTSW 9 39,373,570 (GRCm39) missense probably damaging 1.00
Z1177:Or8g34 UTSW 9 39,372,997 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCTTTAGTACTTGCAGTTCC -3'
(R):5'- CCACACTATTTGTTGATTTTGCTGG -3'

Sequencing Primer
(F):5'- AGTACTTGCAGTTCCCACATC -3'
(R):5'- TTTGCTGGTTATGAGAAGAATATGAG -3'
Posted On 2017-03-31