Incidental Mutation 'R5950:Cntnap3'
ID472404
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 044140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5950 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64787769 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 427 (L427F)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: L427F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: L427F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.4350 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Abca15 G A 7: 120,382,656 G1065R probably damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pard3b T A 1: 62,216,531 Y572N probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkd2l1 A C 19: 44,152,090 V608G probably benign Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tank A G 2: 61,653,569 probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zc3h6 C A 2: 128,997,790 Y174* probably null Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGAGATCAAACCCATGTCTTC -3'
(R):5'- ACTACAAGGCTCTTTACCTGTG -3'

Sequencing Primer
(F):5'- GAGATCAAACCCATGTCTTCAAAAAG -3'
(R):5'- GTGTCCTTCACATGCCCACAAC -3'
Posted On2017-03-31