Mutagenetix > Incidental Mutations

Incidental Mutation 'R5950:Cntnap3'

472404

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

044140-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R5950 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64787769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 427 (L427F)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: L427F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: L427F

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.4350

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

93% (75/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	A	17: 28,905,755	Q256L	possibly damaging	Het
Abca15	G	A	7: 120,382,656	G1065R	probably damaging	Het
Acox2	A	T	14: 8,255,793	Y113N	probably benign	Het
Arid4b	T	A	13: 14,191,264		probably benign	Het
Atf6	C	T	1: 170,834,879	G271R	probably damaging	Het
Cct8l1	C	A	5: 25,517,743	F485L	probably benign	Het
Cdk5r2	A	G	1: 74,855,402	E102G	probably damaging	Het
Celsr1	A	T	15: 86,032,500	V424E	probably damaging	Het
Ces1h	T	C	8: 93,362,959	T271A	probably benign	Het
Cfap44	T	C	16: 44,479,847	I1738T	probably damaging	Het
Crybg3	T	C	16: 59,493,571		probably benign	Het
Dis3l2	A	G	1: 87,021,108	D589G	probably damaging	Het
Dlg1	A	G	16: 31,665,583	R10G	probably damaging	Het
Dnajc1	A	C	2: 18,306,941		probably benign	Het
Dpy19l2	T	A	9: 24,581,134	T723S	probably benign	Het
Dsg3	A	T	18: 20,538,529	N764Y	probably damaging	Het
Dst	G	T	1: 34,262,060	R3654L	probably damaging	Het
Evl	C	T	12: 108,675,553	T198I	probably benign	Het
Hectd2	A	G	19: 36,597,239		probably benign	Het
Hsp90b1	A	G	10: 86,701,745	V232A	possibly damaging	Het
Igsf5	T	C	16: 96,372,872	V34A	probably benign	Het
Ikzf2	A	T	1: 69,683,244	N41K	probably damaging	Het
Kif6	G	T	17: 49,715,088	A339S	probably damaging	Het
Klhl1	T	A	14: 96,240,354	D426V	probably damaging	Het
Knop1	A	C	7: 118,853,334	V54G	probably damaging	Het
Lama4	T	A	10: 39,030,448	V270D	probably benign	Het
Lnx2	A	G	5: 147,024,350		probably null	Het
Lrp5	A	T	19: 3,602,333	V1179E	probably benign	Het
Lrpprc	T	G	17: 84,740,170	D878A	possibly damaging	Het
Lrrc14	A	T	15: 76,715,310		probably benign	Het
Ltbp1	A	T	17: 75,273,870	D660V	probably damaging	Het
Macf1	C	G	4: 123,439,436		probably null	Het
Map3k21	C	A	8: 125,941,760	T695K	possibly damaging	Het
Mcm3ap	T	A	10: 76,488,419	D895E	possibly damaging	Het
Mfsd7a	A	T	5: 108,445,485	H162Q	probably damaging	Het
Mink1	T	A	11: 70,609,586	D779E	possibly damaging	Het
Mkrn3	T	C	7: 62,419,719	E108G	probably damaging	Het
Nars	A	G	18: 64,510,485	V141A	possibly damaging	Het
Olfr954	T	C	9: 39,462,337	V299A	probably benign	Het
Pard3b	T	A	1: 62,216,531	Y572N	probably benign	Het
Pcnx3	A	C	19: 5,667,158	M1599R	possibly damaging	Het
Pitx2	A	G	3: 129,218,520	S180G	probably damaging	Het
Pkd2l1	A	C	19: 44,152,090	V608G	probably benign	Het
Pkhd1l1	A	G	15: 44,532,965	D1961G	probably benign	Het
Pxylp1	T	C	9: 96,839,126	T109A	probably damaging	Het
Rai1	T	A	11: 60,187,593	C828S	probably damaging	Het
Ralgapa1	T	A	12: 55,738,265	T737S	possibly damaging	Het
Scn11a	A	G	9: 119,811,124	V235A	probably damaging	Het
Sfxn1	A	T	13: 54,091,287	T134S	probably benign	Het
Skint1	A	G	4: 112,019,335	Y151C	probably benign	Het
Slc11a1	G	T	1: 74,377,176	W54L	probably benign	Het
Soga3	T	C	10: 29,143,648		probably benign	Het
Synpo2l	T	A	14: 20,665,935	Q191L	probably benign	Het
Tank	A	G	2: 61,653,569		probably benign	Het
Tctex1d1	T	G	4: 103,004,250	L147R	probably damaging	Het
Terb1	A	T	8: 104,488,485		probably null	Het
Trdc	T	C	14: 54,144,311		probably benign	Het
Tsen34	A	G	7: 3,694,788	I63V	probably null	Het
Ust	T	C	10: 8,248,101	H257R	probably benign	Het
Vmn2r6	T	C	3: 64,565,231	Q23R	probably benign	Het
Wdr93	A	T	7: 79,773,431	H481L	probably damaging	Het
Xirp2	A	G	2: 67,511,320	T1302A	possibly damaging	Het
Zc3h6	C	A	2: 128,997,790	Y174*	probably null	Het
Zcchc7	T	G	4: 44,931,244	D144E	possibly damaging	Het
Zfp472	T	A	17: 32,977,507	H185Q	possibly damaging	Het
Zfp523	C	A	17: 28,202,558	P66H	probably benign	Het
Zfp712	A	T	13: 67,044,817	L57Q	probably damaging	Het
Zik1	G	A	7: 10,490,571	Q200*	probably null	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGAGAGATCAAACCCATGTCTTC -3'
(R):5'- ACTACAAGGCTCTTTACCTGTG -3'

Sequencing Primer
(F):5'- GAGATCAAACCCATGTCTTCAAAAAG -3'
(R):5'- GTGTCCTTCACATGCCCACAAC -3'

Posted On

2017-03-31