Incidental Mutation 'R5950:Lrpprc'
ID 472421
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 044140-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5950 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 85047598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 878 (D878A)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: D878A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: D878A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000160011
Meta Mutation Damage Score 0.4673 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 119,981,879 (GRCm39) G1065R probably damaging Het
Acox2 A T 14: 8,255,793 (GRCm38) Y113N probably benign Het
Arid4b T A 13: 14,365,849 (GRCm39) probably benign Het
Atf6 C T 1: 170,662,448 (GRCm39) G271R probably damaging Het
Bnip5 T A 17: 29,124,729 (GRCm39) Q256L possibly damaging Het
Cct8l1 C A 5: 25,722,741 (GRCm39) F485L probably benign Het
Cdk5r2 A G 1: 74,894,561 (GRCm39) E102G probably damaging Het
Celsr1 A T 15: 85,916,701 (GRCm39) V424E probably damaging Het
Ces1h T C 8: 94,089,587 (GRCm39) T271A probably benign Het
Cfap44 T C 16: 44,300,210 (GRCm39) I1738T probably damaging Het
Cntnap3 G A 13: 64,935,583 (GRCm39) L427F probably damaging Het
Crybg3 T C 16: 59,313,934 (GRCm39) probably benign Het
Dis3l2 A G 1: 86,948,830 (GRCm39) D589G probably damaging Het
Dlg1 A G 16: 31,484,401 (GRCm39) R10G probably damaging Het
Dnajc1 A C 2: 18,311,752 (GRCm39) probably benign Het
Dpy19l2 T A 9: 24,492,430 (GRCm39) T723S probably benign Het
Dsg3 A T 18: 20,671,586 (GRCm39) N764Y probably damaging Het
Dst G T 1: 34,301,141 (GRCm39) R3654L probably damaging Het
Dynlt5 T G 4: 102,861,447 (GRCm39) L147R probably damaging Het
Evl C T 12: 108,641,812 (GRCm39) T198I probably benign Het
Hectd2 A G 19: 36,574,639 (GRCm39) probably benign Het
Hsp90b1 A G 10: 86,537,609 (GRCm39) V232A possibly damaging Het
Igsf5 T C 16: 96,174,072 (GRCm39) V34A probably benign Het
Ikzf2 A T 1: 69,722,403 (GRCm39) N41K probably damaging Het
Kif6 G T 17: 50,022,116 (GRCm39) A339S probably damaging Het
Klhl1 T A 14: 96,477,790 (GRCm39) D426V probably damaging Het
Knop1 A C 7: 118,452,557 (GRCm39) V54G probably damaging Het
Lama4 T A 10: 38,906,444 (GRCm39) V270D probably benign Het
Lnx2 A G 5: 146,961,160 (GRCm39) probably null Het
Lrp5 A T 19: 3,652,333 (GRCm39) V1179E probably benign Het
Lrrc14 A T 15: 76,599,510 (GRCm39) probably benign Het
Ltbp1 A T 17: 75,580,865 (GRCm39) D660V probably damaging Het
Macf1 C G 4: 123,333,229 (GRCm39) probably null Het
Map3k21 C A 8: 126,668,499 (GRCm39) T695K possibly damaging Het
Mcm3ap T A 10: 76,324,253 (GRCm39) D895E possibly damaging Het
Mink1 T A 11: 70,500,412 (GRCm39) D779E possibly damaging Het
Mkrn3 T C 7: 62,069,467 (GRCm39) E108G probably damaging Het
Mtcl3 T C 10: 29,019,644 (GRCm39) probably benign Het
Nars1 A G 18: 64,643,556 (GRCm39) V141A possibly damaging Het
Or8g34 T C 9: 39,373,633 (GRCm39) V299A probably benign Het
Pard3b T A 1: 62,255,690 (GRCm39) Y572N probably benign Het
Pcnx3 A C 19: 5,717,186 (GRCm39) M1599R possibly damaging Het
Pitx2 A G 3: 129,012,169 (GRCm39) S180G probably damaging Het
Pkd2l1 A C 19: 44,140,529 (GRCm39) V608G probably benign Het
Pkhd1l1 A G 15: 44,396,361 (GRCm39) D1961G probably benign Het
Pxylp1 T C 9: 96,721,179 (GRCm39) T109A probably damaging Het
Rai1 T A 11: 60,078,419 (GRCm39) C828S probably damaging Het
Ralgapa1 T A 12: 55,785,050 (GRCm39) T737S possibly damaging Het
Scn11a A G 9: 119,640,190 (GRCm39) V235A probably damaging Het
Sfxn1 A T 13: 54,245,306 (GRCm39) T134S probably benign Het
Skint1 A G 4: 111,876,532 (GRCm39) Y151C probably benign Het
Slc11a1 G T 1: 74,416,335 (GRCm39) W54L probably benign Het
Slc49a3 A T 5: 108,593,351 (GRCm39) H162Q probably damaging Het
Synpo2l T A 14: 20,716,003 (GRCm39) Q191L probably benign Het
Tank A G 2: 61,483,913 (GRCm39) probably benign Het
Terb1 A T 8: 105,215,117 (GRCm39) probably null Het
Trdc T C 14: 54,381,768 (GRCm39) probably benign Het
Tsen34 A G 7: 3,697,787 (GRCm39) I63V probably null Het
Ust T C 10: 8,123,865 (GRCm39) H257R probably benign Het
Vmn2r6 T C 3: 64,472,652 (GRCm39) Q23R probably benign Het
Wdr93 A T 7: 79,423,179 (GRCm39) H481L probably damaging Het
Xirp2 A G 2: 67,341,664 (GRCm39) T1302A possibly damaging Het
Zc3h6 C A 2: 128,839,710 (GRCm39) Y174* probably null Het
Zcchc7 T G 4: 44,931,244 (GRCm39) D144E possibly damaging Het
Zfp472 T A 17: 33,196,481 (GRCm39) H185Q possibly damaging Het
Zfp523 C A 17: 28,421,532 (GRCm39) P66H probably benign Het
Zfp712 A T 13: 67,192,881 (GRCm39) L57Q probably damaging Het
Zik1 G A 7: 10,224,498 (GRCm39) Q200* probably null Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGCTTCCTATTATTATTGGGACTG -3'
(R):5'- ATGCCATCAGTATGTGCTAGCAG -3'

Sequencing Primer
(F):5'- GGGACTGAATTCGATTAACATGAATC -3'
(R):5'- TATGTGCTAGCAGATAAAGGACTCTG -3'
Posted On 2017-03-31