Incidental Mutation 'R5950:Pkd2l1'
ID472427
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 044140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5950 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44152090 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 608 (V608G)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably benign
Transcript: ENSMUST00000042026
AA Change: V608G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: V608G

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 93% (75/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,905,755 Q256L possibly damaging Het
Abca15 G A 7: 120,382,656 G1065R probably damaging Het
Acox2 A T 14: 8,255,793 Y113N probably benign Het
Arid4b T A 13: 14,191,264 probably benign Het
Atf6 C T 1: 170,834,879 G271R probably damaging Het
Cct8l1 C A 5: 25,517,743 F485L probably benign Het
Cdk5r2 A G 1: 74,855,402 E102G probably damaging Het
Celsr1 A T 15: 86,032,500 V424E probably damaging Het
Ces1h T C 8: 93,362,959 T271A probably benign Het
Cfap44 T C 16: 44,479,847 I1738T probably damaging Het
Cntnap3 G A 13: 64,787,769 L427F probably damaging Het
Crybg3 T C 16: 59,493,571 probably benign Het
Dis3l2 A G 1: 87,021,108 D589G probably damaging Het
Dlg1 A G 16: 31,665,583 R10G probably damaging Het
Dnajc1 A C 2: 18,306,941 probably benign Het
Dpy19l2 T A 9: 24,581,134 T723S probably benign Het
Dsg3 A T 18: 20,538,529 N764Y probably damaging Het
Dst G T 1: 34,262,060 R3654L probably damaging Het
Evl C T 12: 108,675,553 T198I probably benign Het
Hectd2 A G 19: 36,597,239 probably benign Het
Hsp90b1 A G 10: 86,701,745 V232A possibly damaging Het
Igsf5 T C 16: 96,372,872 V34A probably benign Het
Ikzf2 A T 1: 69,683,244 N41K probably damaging Het
Kif6 G T 17: 49,715,088 A339S probably damaging Het
Klhl1 T A 14: 96,240,354 D426V probably damaging Het
Knop1 A C 7: 118,853,334 V54G probably damaging Het
Lama4 T A 10: 39,030,448 V270D probably benign Het
Lnx2 A G 5: 147,024,350 probably null Het
Lrp5 A T 19: 3,602,333 V1179E probably benign Het
Lrpprc T G 17: 84,740,170 D878A possibly damaging Het
Lrrc14 A T 15: 76,715,310 probably benign Het
Ltbp1 A T 17: 75,273,870 D660V probably damaging Het
Macf1 C G 4: 123,439,436 probably null Het
Map3k21 C A 8: 125,941,760 T695K possibly damaging Het
Mcm3ap T A 10: 76,488,419 D895E possibly damaging Het
Mfsd7a A T 5: 108,445,485 H162Q probably damaging Het
Mink1 T A 11: 70,609,586 D779E possibly damaging Het
Mkrn3 T C 7: 62,419,719 E108G probably damaging Het
Nars A G 18: 64,510,485 V141A possibly damaging Het
Olfr954 T C 9: 39,462,337 V299A probably benign Het
Pard3b T A 1: 62,216,531 Y572N probably benign Het
Pcnx3 A C 19: 5,667,158 M1599R possibly damaging Het
Pitx2 A G 3: 129,218,520 S180G probably damaging Het
Pkhd1l1 A G 15: 44,532,965 D1961G probably benign Het
Pxylp1 T C 9: 96,839,126 T109A probably damaging Het
Rai1 T A 11: 60,187,593 C828S probably damaging Het
Ralgapa1 T A 12: 55,738,265 T737S possibly damaging Het
Scn11a A G 9: 119,811,124 V235A probably damaging Het
Sfxn1 A T 13: 54,091,287 T134S probably benign Het
Skint1 A G 4: 112,019,335 Y151C probably benign Het
Slc11a1 G T 1: 74,377,176 W54L probably benign Het
Soga3 T C 10: 29,143,648 probably benign Het
Synpo2l T A 14: 20,665,935 Q191L probably benign Het
Tank A G 2: 61,653,569 probably benign Het
Tctex1d1 T G 4: 103,004,250 L147R probably damaging Het
Terb1 A T 8: 104,488,485 probably null Het
Trdc T C 14: 54,144,311 probably benign Het
Tsen34 A G 7: 3,694,788 I63V probably null Het
Ust T C 10: 8,248,101 H257R probably benign Het
Vmn2r6 T C 3: 64,565,231 Q23R probably benign Het
Wdr93 A T 7: 79,773,431 H481L probably damaging Het
Xirp2 A G 2: 67,511,320 T1302A possibly damaging Het
Zc3h6 C A 2: 128,997,790 Y174* probably null Het
Zcchc7 T G 4: 44,931,244 D144E possibly damaging Het
Zfp472 T A 17: 32,977,507 H185Q possibly damaging Het
Zfp523 C A 17: 28,202,558 P66H probably benign Het
Zfp712 A T 13: 67,044,817 L57Q probably damaging Het
Zik1 G A 7: 10,490,571 Q200* probably null Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCGTTGAACAAAGCCCAG -3'
(R):5'- AATGCCTTTGACTTGTACCTGG -3'

Sequencing Primer
(F):5'- GTCGTTGAACAAAGCCCAGAATTTG -3'
(R):5'- ACTTGTACCTGGGGGCTTGAG -3'
Posted On2017-03-31