Incidental Mutation 'R5971:Kitl'
ID 472429
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission 044154-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R5971 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 100015630-100100416 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 100076906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably null
Transcript: ENSMUST00000020129
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105283
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130190
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 87% (27/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5031439G07Rik G T 15: 84,987,662 A4D possibly damaging Het
6820408C15Rik T C 2: 152,440,870 V215A probably damaging Het
Abcc9 A G 6: 142,639,575 F801S probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adam39 C T 8: 40,824,593 A7V probably benign Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Ctnna1 T C 18: 35,154,514 V92A probably benign Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Slc13a1 T C 6: 24,133,657 T199A probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
Gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
Sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
R7368:Kitl UTSW 10 100016081 missense probably benign 0.02
R8010:Kitl UTSW 10 100051903 missense probably benign 0.22
R8234:Kitl UTSW 10 100051846 missense probably damaging 1.00
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGACTTGAAGAGCCCC -3'
(R):5'- AGCCACTTCAGTATTGCAGTAAAAC -3'

Sequencing Primer
(F):5'- TTGAAGAGCCCCCTGAATCTG -3'
(R):5'- TGCAGTAAAACTACAATAGACTCTTG -3'
Posted On 2017-04-03