Mutagenetix > Incidental Mutations

Incidental Mutation 'R0503:Ptpru'

47243

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

038698-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 131793643 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 784 (N784S)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]

Predicted Effect

probably benign
Transcript: ENSMUST00000030741
AA Change: N794S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: N794S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097860
AA Change: N722S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: N722S

Domain	Start	End	E-Value	Type
Pfam:MAM	1	116	4.1e-30	PFAM
IG	123	211	4.93e-3	SMART
FN3	213	296	3.79e-2	SMART
FN3	312	400	2.5e-2	SMART
FN3	416	504	3.62e-8	SMART
low complexity region	555	569	N/A	INTRINSIC
low complexity region	595	605	N/A	INTRINSIC
transmembrane domain	675	697	N/A	INTRINSIC
Blast:PTPc	736	878	3e-49	BLAST
SCOP:d1jlna_	790	886	9e-19	SMART
PDB:2C7S\|A	797	878	7e-22	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000105987
AA Change: N784S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: N784S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154224

Meta Mutation Damage Score

0.0668

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,947,495	H755R	possibly damaging	Het
Atp2c2	A	G	8: 119,734,577	E279G	probably null	Het
Ccdc65	G	T	15: 98,709,160	D83Y	probably damaging	Het
Cd200r2	T	A	16: 44,877,962	M1K	probably null	Het
Clca4c-ps	A	T	3: 144,879,822		noncoding transcript	Het
Col6a6	A	T	9: 105,767,351	M1246K	probably benign	Het
Comp	A	T	8: 70,375,734	N130I	possibly damaging	Het
Crot	A	G	5: 8,976,075	V304A	possibly damaging	Het
Dapk1	T	A	13: 60,730,848		probably null	Het
Dspp	A	T	5: 104,177,256	D495V	unknown	Het
Erich2	A	T	2: 70,509,699	R169S	probably damaging	Het
Erich2	C	A	2: 70,540,775	S426R	unknown	Het
Gab1	C	T	8: 80,800,142	R109H	probably damaging	Het
Ggcx	GTCTAT	GTCTATCTAT	6: 72,429,157		probably null	Het
Gria1	T	G	11: 57,189,716	V175G	probably damaging	Het
Hmcn1	C	T	1: 150,859,252	V170M	probably damaging	Het
Irx4	T	A	13: 73,266,584		probably null	Het
Katnb1	A	G	8: 95,095,174	T212A	probably damaging	Het
Kirrel	A	G	3: 87,097,802	S80P	probably benign	Het
Lrrc75b	T	C	10: 75,553,654	T81A	possibly damaging	Het
Macf1	A	G	4: 123,469,815	S1775P	probably damaging	Het
Mmp10	A	T	9: 7,507,339	I387F	probably damaging	Het
Mphosph10	A	T	7: 64,389,893	C110S	probably benign	Het
Mpig6b	A	G	17: 35,064,448		probably benign	Het
Mrps27	G	T	13: 99,409,795		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mybpc2	A	G	7: 44,512,570		probably benign	Het
Nbea	C	T	3: 55,642,836	G2724S	possibly damaging	Het
Nck2	A	G	1: 43,533,568	M1V	probably null	Het
Nefl	T	A	14: 68,083,983	D7E	probably benign	Het
Nktr	T	A	9: 121,750,740		probably benign	Het
Nlrp12	C	T	7: 3,249,377	E55K	probably damaging	Het
Nsun7	T	A	5: 66,283,581		probably benign	Het
Olfr1214	C	T	2: 88,987,978	V75I	probably benign	Het
Olfr523	T	C	7: 140,176,441	V113A	possibly damaging	Het
Olfr586	A	T	7: 103,122,436	M112K	possibly damaging	Het
Olfr729	T	A	14: 50,148,478	Y132F	probably damaging	Het
Olfr769	T	C	10: 129,111,802	T208A	probably damaging	Het
Olfr961	A	G	9: 39,647,476	Y250C	probably damaging	Het
Pcdh15	A	G	10: 74,210,385	T165A	probably damaging	Het
Pikfyve	A	T	1: 65,219,899	H410L	probably damaging	Het
Polr3c	A	T	3: 96,713,636		probably null	Het
Ptdss2	T	A	7: 141,151,797		probably benign	Het
Ptprg	A	G	14: 12,237,138	M1386V	possibly damaging	Het
Rfx4	T	A	10: 84,894,332	I495K	possibly damaging	Het
Serpina12	C	A	12: 104,031,159	A368S	probably damaging	Het
Tmem39b	A	C	4: 129,686,986	Y238D	possibly damaging	Het
Tspan11	T	C	6: 127,939,112	W124R	probably benign	Het
Ttll10	T	C	4: 156,047,548		probably benign	Het
Tyro3	T	C	2: 119,803,230		probably benign	Het
Unc79	A	G	12: 103,078,868	M644V	probably benign	Het
Vmn1r196	G	A	13: 22,293,387	M65I	probably benign	Het
Vmn2r85	T	C	10: 130,422,740	Y482C	probably damaging	Het
Zfp940	A	G	7: 29,846,020		probably benign	Het
Zfyve9	A	T	4: 108,719,764	L40*	probably null	Het
Zkscan1	T	A	5: 138,093,326	I107N	probably damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AGGAGTGTCTGAAGACCTGCCTAAC -3'
(R):5'- GTGGCCCTTCCACATCTAAAGAAGC -3'

Sequencing Primer
(F):5'- GCTCGAAGCAGCCTCTAAG -3'
(R):5'- GCATTTGCAATGCTGTAGACTTC -3'

Posted On

2013-06-12