Mutagenetix > Incidental Mutation

Incidental Mutation 'R5964:Slx4'

472435

Institutional Source

Beutler Lab

Gene Symbol

Slx4

Ensembl Gene

ENSMUSG00000039738

Gene Name

SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)

Synonyms

Btbd12, D16Bwg1016e

MMRRC Submission

044149-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5964 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3979105-4003770 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 4000951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040790] [ENSMUST00000171658] [ENSMUST00000171762]

AlphaFold

Q6P1D7

Predicted Effect

probably benign
Transcript: ENSMUST00000040790

SMART Domains

Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000165830

Predicted Effect

probably benign
Transcript: ENSMUST00000171658

Predicted Effect

probably benign
Transcript: ENSMUST00000171762

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

96% (87/91)

MGI Phenotype

FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	G	A	3: 89,343,567	Q581*	probably null	Het
Agl	A	G	3: 116,793,774	V44A	probably damaging	Het
Alpk3	T	A	7: 81,092,260	D608E	possibly damaging	Het
Aspm	C	A	1: 139,455,227		probably benign	Het
Bbs2	T	C	8: 94,068,367	N692S	probably benign	Het
Bend4	A	G	5: 67,417,818	I240T	probably benign	Het
Casp8	G	T	1: 58,833,736	R277L	possibly damaging	Het
Ccdc61	A	T	7: 18,900,940	I123N	probably damaging	Het
Ccr9	T	G	9: 123,779,434	I60M	probably benign	Het
Cd163	T	A	6: 124,326,572	W1066R	probably benign	Het
Cd226	A	T	18: 89,207,183	H68L	probably benign	Het
Cdkn3	T	A	14: 46,767,217	C79S	probably null	Het
Cnnm1	A	T	19: 43,469,723	E658V	probably benign	Het
Cog7	T	C	7: 121,956,029	R304G	probably damaging	Het
Cpt1a	T	A	19: 3,365,760	V286E	possibly damaging	Het
Creg2	C	A	1: 39,624,954	R212L	probably benign	Het
Cyp26a1	T	G	19: 37,699,962	S311A	probably damaging	Het
Cyp2b10	T	C	7: 25,926,223	Y484H	probably benign	Het
Cyp3a44	T	A	5: 145,788,467	Y308F	possibly damaging	Het
Dlg5	A	G	14: 24,164,089	V744A	probably benign	Het
Dlgap2	T	A	8: 14,727,128	Y124*	probably null	Het
Dnah3	T	C	7: 119,922,880	D4030G	probably benign	Het
Dnah5	A	G	15: 28,458,584	T4456A	possibly damaging	Het
Dtx2	T	A	5: 136,023,699	V347D	probably benign	Het
Gigyf2	C	T	1: 87,407,167	T294M	probably damaging	Het
Gli3	C	G	13: 15,726,162	S1378*	probably null	Het
Gm884	A	G	11: 103,542,120	S1232P	possibly damaging	Het
Gnao1	G	A	8: 93,966,999	D337N	probably benign	Het
Gp2	T	A	7: 119,449,129	Q422L	probably benign	Het
Ifit1	T	A	19: 34,648,469	M335K	possibly damaging	Het
Ism1	T	C	2: 139,678,757	S30P	probably benign	Het
Itgax	A	G	7: 128,140,447	D677G	probably damaging	Het
Kansl1l	G	A	1: 66,725,922	A442V	probably damaging	Het
Kif13a	T	C	13: 46,771,524	I311M	probably damaging	Het
Lsm14b	T	A	2: 180,031,425	S84R	probably benign	Het
Lzts3	A	G	2: 130,636,288	Y297H	probably damaging	Het
Map4k3	A	G	17: 80,644,762	I205T	probably damaging	Het
Matn2	A	T	15: 34,410,165	N501I	probably damaging	Het
Mctp2	T	C	7: 72,103,177	E776G	probably damaging	Het
Mex3d	A	T	10: 80,382,587	N265K	probably damaging	Het
Myo5a	A	G	9: 75,203,833	T1534A	probably benign	Het
Ncoa7	T	C	10: 30,704,636	M35V	probably damaging	Het
Nek4	G	A	14: 30,957,079		probably null	Het
Ngrn	T	C	7: 80,261,933		probably null	Het
Nlrp1a	T	A	11: 71,123,020	Q468L	probably benign	Het
Olfr1450	A	C	19: 12,954,531	Q314P	probably benign	Het
Olfr743	T	A	14: 50,534,198	M262K	probably damaging	Het
Phtf2	T	C	5: 20,775,934	D433G	probably damaging	Het
Prdm13	G	A	4: 21,683,852	Q140*	probably null	Het
Prtg	G	A	9: 72,892,254	G778E	probably benign	Het
Pum3	T	C	19: 27,420,051	E308G	probably damaging	Het
Pwp1	T	G	10: 85,882,886	F306V	probably damaging	Het
Rab24	A	T	13: 55,321,576	Y27N	probably damaging	Het
Rnf215	T	C	11: 4,135,898	F126L	probably benign	Het
Samd13	A	T	3: 146,680,696		probably benign	Het
Serac1	T	A	17: 6,065,049	H213L	probably benign	Het
Slc45a3	A	G	1: 131,978,073	E278G	probably damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Smarca4	C	A	9: 21,647,430	T631K	probably benign	Het
Snx16	C	T	3: 10,434,481	R163Q	possibly damaging	Het
Stk40	T	C	4: 126,128,895	V140A	probably damaging	Het
Tcf12	A	T	9: 71,868,240	D409E	probably damaging	Het
Tgfbr2	G	T	9: 116,110,255	T168K	possibly damaging	Het
Ticam1	G	T	17: 56,271,703	H131N	probably damaging	Het
Ttn	C	A	2: 76,713,511	E31298*	probably null	Het
Ttn	C	A	2: 76,829,888	R7458I	possibly damaging	Het
Usp7	A	G	16: 8,712,102	V133A	possibly damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Wdfy4	T	C	14: 33,106,011	E1118G	probably damaging	Het
Zfp81	G	C	17: 33,336,845	P3A	probably damaging	Het
Znhit6	A	G	3: 145,576,933	K21R	possibly damaging	Het

Other mutations in Slx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Slx4	APN	16	3990888	missense	probably benign	0.17
IGL01767:Slx4	APN	16	3990248	missense	probably benign	0.01
IGL02525:Slx4	APN	16	3980597	missense	probably damaging	1.00
slim	UTSW	16	3990910	nonsense	probably null
R0033:Slx4	UTSW	16	3988000	missense	probably benign	0.08
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0363:Slx4	UTSW	16	3980089	missense	probably damaging	1.00
R0433:Slx4	UTSW	16	3986018	missense	probably benign	0.01
R0993:Slx4	UTSW	16	3985825	missense	probably benign	0.00
R1083:Slx4	UTSW	16	3990910	nonsense	probably null
R1373:Slx4	UTSW	16	3985510	missense	probably benign	0.02
R1710:Slx4	UTSW	16	3999158	missense	probably benign	0.15
R1712:Slx4	UTSW	16	3991594	missense	probably damaging	0.99
R1874:Slx4	UTSW	16	3986848	missense	probably benign	0.25
R1937:Slx4	UTSW	16	3987166	makesense	probably null
R2008:Slx4	UTSW	16	3979921	missense	probably damaging	1.00
R2156:Slx4	UTSW	16	3986359	missense	probably benign	0.00
R2427:Slx4	UTSW	16	3988987	missense	probably damaging	0.99
R3765:Slx4	UTSW	16	3980986	missense	probably damaging	1.00
R3890:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R3891:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R4465:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4467:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4497:Slx4	UTSW	16	3994909	missense	probably damaging	1.00
R4882:Slx4	UTSW	16	3980996	critical splice acceptor site	probably null
R5119:Slx4	UTSW	16	4001199	missense	possibly damaging	0.89
R5384:Slx4	UTSW	16	3990805	missense	probably damaging	1.00
R5472:Slx4	UTSW	16	3991540	missense	probably benign	0.13
R5578:Slx4	UTSW	16	3986862	missense	probably damaging	1.00
R5582:Slx4	UTSW	16	3985788	missense	possibly damaging	0.93
R5696:Slx4	UTSW	16	3979967	missense	probably damaging	1.00
R5827:Slx4	UTSW	16	4001284	missense	possibly damaging	0.94
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6345:Slx4	UTSW	16	3990850	missense	probably benign	0.06
R6612:Slx4	UTSW	16	3985276	missense	probably damaging	0.99
R6979:Slx4	UTSW	16	3985015	missense	probably damaging	0.96
R6989:Slx4	UTSW	16	3995838	missense	probably damaging	1.00
R7171:Slx4	UTSW	16	3990786	missense	probably benign
R7214:Slx4	UTSW	16	3988980	missense	probably benign	0.18
R7354:Slx4	UTSW	16	3987099	missense	probably benign	0.28
R7490:Slx4	UTSW	16	3980131	missense	possibly damaging	0.91
R7545:Slx4	UTSW	16	3999300	missense	probably benign	0.11
R7547:Slx4	UTSW	16	3985572	missense	probably benign	0.05
R7790:Slx4	UTSW	16	3986982	missense	probably benign	0.03
R8119:Slx4	UTSW	16	3985272	nonsense	probably null
R8815:Slx4	UTSW	16	3985594	missense	probably benign	0.26
R8955:Slx4	UTSW	16	3990247	missense	probably benign
R9205:Slx4	UTSW	16	3988063	missense	possibly damaging	0.74
R9321:Slx4	UTSW	16	3986790	missense	probably benign	0.06
R9364:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9544:Slx4	UTSW	16	3980053	missense	probably damaging	0.97
R9554:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9632:Slx4	UTSW	16	3986105	missense	probably benign	0.00
R9665:Slx4	UTSW	16	3989026	missense	probably benign	0.28
R9718:Slx4	UTSW	16	3986464	missense	possibly damaging	0.73
R9772:Slx4	UTSW	16	4000985	missense

Predicted Primers

PCR Primer
(F):5'- ACAAAATATTTGCTGTCTGGCC -3'
(R):5'- CTTCAGAGAAGAAACCTCGATTAGG -3'

Sequencing Primer
(F):5'- GGCTATCCCACACTCAGTATGTAG -3'
(R):5'- TCGATTAGGCAGCCAGACC -3'

Posted On

2017-04-03