Incidental Mutation 'R5964:Slx4'
ID472435
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene NameSLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
SynonymsBtbd12, D16Bwg1016e
MMRRC Submission 044149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5964 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3979105-4003770 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 4000951 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790] [ENSMUST00000171658] [ENSMUST00000171762]
Predicted Effect probably benign
Transcript: ENSMUST00000040790
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165830
Predicted Effect probably benign
Transcript: ENSMUST00000171658
Predicted Effect probably benign
Transcript: ENSMUST00000171762
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 G A 3: 89,343,567 Q581* probably null Het
Agl A G 3: 116,793,774 V44A probably damaging Het
Alpk3 T A 7: 81,092,260 D608E possibly damaging Het
Aspm C A 1: 139,455,227 probably benign Het
Bbs2 T C 8: 94,068,367 N692S probably benign Het
Bend4 A G 5: 67,417,818 I240T probably benign Het
Casp8 G T 1: 58,833,736 R277L possibly damaging Het
Ccdc61 A T 7: 18,900,940 I123N probably damaging Het
Ccr9 T G 9: 123,779,434 I60M probably benign Het
Cd163 T A 6: 124,326,572 W1066R probably benign Het
Cd226 A T 18: 89,207,183 H68L probably benign Het
Cdkn3 T A 14: 46,767,217 C79S probably null Het
Cnnm1 A T 19: 43,469,723 E658V probably benign Het
Cog7 T C 7: 121,956,029 R304G probably damaging Het
Cpt1a T A 19: 3,365,760 V286E possibly damaging Het
Creg2 C A 1: 39,624,954 R212L probably benign Het
Cyp26a1 T G 19: 37,699,962 S311A probably damaging Het
Cyp2b10 T C 7: 25,926,223 Y484H probably benign Het
Cyp3a44 T A 5: 145,788,467 Y308F possibly damaging Het
Dlg5 A G 14: 24,164,089 V744A probably benign Het
Dlgap2 T A 8: 14,727,128 Y124* probably null Het
Dnah3 T C 7: 119,922,880 D4030G probably benign Het
Dnah5 A G 15: 28,458,584 T4456A possibly damaging Het
Dtx2 T A 5: 136,023,699 V347D probably benign Het
Gigyf2 C T 1: 87,407,167 T294M probably damaging Het
Gli3 C G 13: 15,726,162 S1378* probably null Het
Gm884 A G 11: 103,542,120 S1232P possibly damaging Het
Gnao1 G A 8: 93,966,999 D337N probably benign Het
Gp2 T A 7: 119,449,129 Q422L probably benign Het
Ifit1 T A 19: 34,648,469 M335K possibly damaging Het
Ism1 T C 2: 139,678,757 S30P probably benign Het
Itgax A G 7: 128,140,447 D677G probably damaging Het
Kansl1l G A 1: 66,725,922 A442V probably damaging Het
Kif13a T C 13: 46,771,524 I311M probably damaging Het
Lsm14b T A 2: 180,031,425 S84R probably benign Het
Lzts3 A G 2: 130,636,288 Y297H probably damaging Het
Map4k3 A G 17: 80,644,762 I205T probably damaging Het
Matn2 A T 15: 34,410,165 N501I probably damaging Het
Mctp2 T C 7: 72,103,177 E776G probably damaging Het
Mex3d A T 10: 80,382,587 N265K probably damaging Het
Myo5a A G 9: 75,203,833 T1534A probably benign Het
Ncoa7 T C 10: 30,704,636 M35V probably damaging Het
Nek4 G A 14: 30,957,079 probably null Het
Ngrn T C 7: 80,261,933 probably null Het
Nlrp1a T A 11: 71,123,020 Q468L probably benign Het
Olfr1450 A C 19: 12,954,531 Q314P probably benign Het
Olfr743 T A 14: 50,534,198 M262K probably damaging Het
Phtf2 T C 5: 20,775,934 D433G probably damaging Het
Prdm13 G A 4: 21,683,852 Q140* probably null Het
Prtg G A 9: 72,892,254 G778E probably benign Het
Pum3 T C 19: 27,420,051 E308G probably damaging Het
Pwp1 T G 10: 85,882,886 F306V probably damaging Het
Rab24 A T 13: 55,321,576 Y27N probably damaging Het
Rnf215 T C 11: 4,135,898 F126L probably benign Het
Samd13 A T 3: 146,680,696 probably benign Het
Serac1 T A 17: 6,065,049 H213L probably benign Het
Slc45a3 A G 1: 131,978,073 E278G probably damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Smarca4 C A 9: 21,647,430 T631K probably benign Het
Snx16 C T 3: 10,434,481 R163Q possibly damaging Het
Stk40 T C 4: 126,128,895 V140A probably damaging Het
Tcf12 A T 9: 71,868,240 D409E probably damaging Het
Tgfbr2 G T 9: 116,110,255 T168K possibly damaging Het
Ticam1 G T 17: 56,271,703 H131N probably damaging Het
Ttn C A 2: 76,713,511 E31298* probably null Het
Ttn C A 2: 76,829,888 R7458I possibly damaging Het
Usp7 A G 16: 8,712,102 V133A possibly damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Wdfy4 T C 14: 33,106,011 E1118G probably damaging Het
Zfp81 G C 17: 33,336,845 P3A probably damaging Het
Znhit6 A G 3: 145,576,933 K21R possibly damaging Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
slim UTSW 16 3990910 nonsense probably null
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1373:Slx4 UTSW 16 3985510 missense probably benign 0.02
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1874:Slx4 UTSW 16 3986848 missense probably benign 0.25
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5472:Slx4 UTSW 16 3991540 missense probably benign 0.13
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
R7171:Slx4 UTSW 16 3990786 missense probably benign
R7214:Slx4 UTSW 16 3988980 missense probably benign 0.18
R7354:Slx4 UTSW 16 3987099 missense probably benign 0.28
R7490:Slx4 UTSW 16 3980131 missense possibly damaging 0.91
R7545:Slx4 UTSW 16 3999300 missense probably benign 0.11
R7547:Slx4 UTSW 16 3985572 missense probably benign 0.05
R7790:Slx4 UTSW 16 3986982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAAATATTTGCTGTCTGGCC -3'
(R):5'- CTTCAGAGAAGAAACCTCGATTAGG -3'

Sequencing Primer
(F):5'- GGCTATCCCACACTCAGTATGTAG -3'
(R):5'- TCGATTAGGCAGCCAGACC -3'
Posted On2017-04-03