Incidental Mutation 'R0503:Ttll10'
ID47244
Institutional Source Beutler Lab
Gene Symbol Ttll10
Ensembl Gene ENSMUSG00000029074
Gene Nametubulin tyrosine ligase-like family, member 10
Synonyms4930595O22Rik, Ttll5, 4833412E22Rik
MMRRC Submission 038698-MU
Accession Numbers

Genbank: NM_029264; MGI: 1921855

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156034840-156059414 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 156047548 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051509] [ENSMUST00000184348] [ENSMUST00000184684]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030951
SMART Domains Protein: ENSMUSP00000030951
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051509
SMART Domains Protein: ENSMUSP00000055671
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
low complexity region 104 118 N/A INTRINSIC
Pfam:TTL 189 507 1.8e-48 PFAM
low complexity region 541 583 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 622 638 N/A INTRINSIC
low complexity region 652 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097731
SMART Domains Protein: ENSMUSP00000095337
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 92 102 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153649
SMART Domains Protein: ENSMUSP00000116933
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183563
Predicted Effect probably benign
Transcript: ENSMUST00000184348
SMART Domains Protein: ENSMUSP00000139316
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 92 102 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:TTL 218 536 7.9e-48 PFAM
low complexity region 570 612 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 681 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184684
SMART Domains Protein: ENSMUSP00000139077
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Pfam:TTL 100 418 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184750
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Zkscan1 T A 5: 138,093,326 I107N probably damaging Het
Other mutations in Ttll10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ttll10 APN 4 156046894 missense probably benign 0.09
IGL02109:Ttll10 APN 4 156047480 missense probably benign
IGL02121:Ttll10 APN 4 156048433 missense probably benign 0.04
F6893:Ttll10 UTSW 4 156048318 missense probably benign 0.00
R0366:Ttll10 UTSW 4 156035155 missense probably damaging 0.97
R0502:Ttll10 UTSW 4 156047548 splice site probably benign
R0523:Ttll10 UTSW 4 156045361 nonsense probably null
R0865:Ttll10 UTSW 4 156043678 missense probably damaging 1.00
R0907:Ttll10 UTSW 4 156036164 nonsense probably null
R1125:Ttll10 UTSW 4 156035038 missense possibly damaging 0.73
R1555:Ttll10 UTSW 4 156035139 missense probably benign 0.00
R1797:Ttll10 UTSW 4 156047567 missense probably damaging 0.96
R3899:Ttll10 UTSW 4 156035800 missense probably damaging 1.00
R4426:Ttll10 UTSW 4 156048561 missense possibly damaging 0.55
R5715:Ttll10 UTSW 4 156045391 missense probably damaging 1.00
R5762:Ttll10 UTSW 4 156034981 missense possibly damaging 0.93
R5814:Ttll10 UTSW 4 156047627 missense possibly damaging 0.51
R5958:Ttll10 UTSW 4 156036066 intron probably null
R5994:Ttll10 UTSW 4 156048732 intron probably null
R6084:Ttll10 UTSW 4 156045357 missense probably benign 0.34
R7027:Ttll10 UTSW 4 156035801 missense possibly damaging 0.70
R8010:Ttll10 UTSW 4 156047161
Z1176:Ttll10 UTSW 4 156048517
Z1177:Ttll10 UTSW 4 156047438
Predicted Primers PCR Primer
(F):5'- AGGAATGGCTGCCGATAGCAAC -3'
(R):5'- TCCACACTACATGGACTCTGCCTG -3'

Sequencing Primer
(F):5'- GCTGCCGATAGCAACATCTTG -3'
(R):5'- GGTGTAATGACCCTCAGGC -3'
Posted On2013-06-12