Incidental Mutation 'R5217:Acbd3'
ID472441
Institutional Source Beutler Lab
Gene Symbol Acbd3
Ensembl Gene ENSMUSG00000026499
Gene Nameacyl-Coenzyme A binding domain containing 3
SynonymsD1Ertd10e, 8430407O11Rik, Pap7, Gocap1
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5217 (G1)
Quality Score46
Status Validated
Chromosome1
Chromosomal Location180726043-180754204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180726373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 91 (Y91C)
Ref Sequence ENSEMBL: ENSMUSP00000027780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027780]
Predicted Effect probably benign
Transcript: ENSMUST00000027780
AA Change: Y91C

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027780
Gene: ENSMUSG00000026499
AA Change: Y91C

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ACBP 81 167 3.2e-18 PFAM
coiled coil region 173 252 N/A INTRINSIC
low complexity region 268 305 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Pfam:GOLD_2 394 524 2.5e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Acbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Acbd3 APN 1 180745105 missense possibly damaging 0.61
R0321:Acbd3 UTSW 1 180752305 missense probably damaging 1.00
R0365:Acbd3 UTSW 1 180738612 missense probably damaging 1.00
R0524:Acbd3 UTSW 1 180747059 small deletion probably benign
R0733:Acbd3 UTSW 1 180752218 missense possibly damaging 0.75
R0884:Acbd3 UTSW 1 180747059 small deletion probably benign
R1074:Acbd3 UTSW 1 180738548 nonsense probably null
R1327:Acbd3 UTSW 1 180733183 missense possibly damaging 0.95
R1352:Acbd3 UTSW 1 180738530 missense probably damaging 1.00
R1820:Acbd3 UTSW 1 180745138 missense probably benign 0.13
R4697:Acbd3 UTSW 1 180721944 unclassified probably benign
R5187:Acbd3 UTSW 1 180736732 nonsense probably null
R5368:Acbd3 UTSW 1 180722095 unclassified probably benign
R6018:Acbd3 UTSW 1 180752338 missense possibly damaging 0.88
R7072:Acbd3 UTSW 1 180726369 missense probably benign
R7366:Acbd3 UTSW 1 180734499 missense probably benign 0.41
X0027:Acbd3 UTSW 1 180747030 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAACGTAGAGCAGCTCGAG -3'
(R):5'- AAACCAGGGTTCTAGGTCTCTC -3'

Sequencing Primer
(F):5'- TAGAGCAGCTCGAGGTGTC -3'
(R):5'- TCTCTCAGGGGTGTGACCAG -3'
Posted On2017-04-03