Mutagenetix > Incidental Mutations

Incidental Mutation 'R5240:Tkt'

472454

Institutional Source

Beutler Lab

Gene Symbol

Tkt

Ensembl Gene

ENSMUSG00000021957

Gene Name

transketolase

Synonyms

p68

MMRRC Submission

042811-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5240 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30548359-30574720 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30565678 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 210 (G210C)

Ref Sequence

ENSEMBL: ENSMUSP00000022529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022529]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022529
AA Change: G210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: G210C

Domain	Start	End	E-Value	Type
Pfam:Transketolase_N	14	284	1.4e-46	PFAM
Pfam:E1_dh	108	239	6.9e-11	PFAM
Transket_pyr	315	479	1.52e-42	SMART
Pfam:Transketolase_C	490	612	3.9e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160406

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223633

Predicted Effect

probably benign
Transcript: ENSMUST00000223717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225857

Meta Mutation Damage Score

0.9633

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdc42bpg	T	G	19: 6,315,899	L786R	probably damaging	Het
Cfap73	C	T	5: 120,629,707	V260I	probably damaging	Het
Chchd10	A	T	10: 75,937,449	N131I	probably damaging	Het
Chn2	T	C	6: 54,220,695	V190A	probably benign	Het
Clec2l	C	T	6: 38,673,452	T64I	probably damaging	Het
Cpeb3	T	A	19: 37,174,515	T154S	probably damaging	Het
D130043K22Rik	A	G	13: 24,877,977	E643G	probably damaging	Het
Ddx31	A	G	2: 28,846,030	M127V	probably benign	Het
Dennd1b	A	G	1: 139,062,877	Y193C	probably damaging	Het
Dgke	T	A	11: 89,050,685	D288V	probably damaging	Het
Dst	T	A	1: 34,208,558	L1683*	probably null	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
E130116L18Rik	G	T	5: 25,223,020		probably benign	Het
Eif2b5	G	A	16: 20,501,398	V115I	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fgfr3	A	T	5: 33,730,038	T234S	probably damaging	Het
Gipc2	A	T	3: 152,102,662	D251E	possibly damaging	Het
Gm11787	A	C	4: 3,511,810		noncoding transcript	Het
Gm5538	A	C	3: 59,752,028	T301P	probably damaging	Het
Haus6	A	G	4: 86,583,178	Y819H	possibly damaging	Het
Homez	G	A	14: 54,858,074	A59V	probably damaging	Het
Iffo1	T	C	6: 125,152,460	V363A	probably benign	Het
Ifit2	T	A	19: 34,574,396	D445E	probably benign	Het
Ipo9	A	C	1: 135,389,606		probably benign	Het
Kcnv1	C	T	15: 45,113,244	G216R	probably damaging	Het
Kdm6b	A	C	11: 69,401,904		probably benign	Het
Mplkip	T	C	13: 17,695,719	S79P	probably damaging	Het
Nae1	T	C	8: 104,523,144		probably benign	Het
Nfe2l2	A	T	2: 75,676,009	N582K	possibly damaging	Het
Nsmce4a	G	A	7: 130,537,024	R297C	probably damaging	Het
Olfr397	T	C	11: 73,964,806	L66P	probably damaging	Het
Olfr411	T	A	11: 74,347,242	D114V	probably damaging	Het
Olfr495	A	T	7: 108,395,702	D194V	probably damaging	Het
Osbp	T	A	19: 11,978,290	F357I	probably damaging	Het
Pcdhb4	A	G	18: 37,309,926	D763G	possibly damaging	Het
Pcdhgb2	A	C	18: 37,691,050	I365L	possibly damaging	Het
Pde6g	A	G	11: 120,448,086		probably benign	Het
Pigo	C	A	4: 43,020,675	V756L	possibly damaging	Het
Pkhd1	G	T	1: 20,275,641	T2721K	probably benign	Het
Pls1	A	T	9: 95,776,622		probably null	Het
Prim2	A	G	1: 33,480,316		probably benign	Het
Prkd2	T	A	7: 16,855,786	I471N	probably benign	Het
Prrc2b	C	T	2: 32,206,396	T593I	probably benign	Het
Ptch2	C	A	4: 117,106,138		probably benign	Het
Pth	A	T	7: 113,385,844	D107E	probably damaging	Het
Pycr2	A	C	1: 180,907,623	Q315P	probably benign	Het
Rbpj	A	T	5: 53,649,440	Y209F	probably damaging	Het
Ripk4	C	A	16: 97,743,767	R560L	probably damaging	Het
Sdr42e1	T	C	8: 117,663,282	R207G	probably benign	Het
Sipa1l1	A	G	12: 82,341,588	Y196C	possibly damaging	Het
Smarcc2	T	C	10: 128,481,006		probably null	Het
Stom	T	A	2: 35,336,877	I15F	probably benign	Het
Sugp2	G	T	8: 70,243,275	L299F	probably benign	Het
Tbrg4	A	T	11: 6,617,516		probably null	Het
Tmem163	G	A	1: 127,491,552		probably benign	Het
Trip12	A	G	1: 84,794,133	I98T	probably benign	Het
Unc5b	A	G	10: 60,774,640	I466T	probably damaging	Het
Unc79	T	A	12: 103,070,751	F599L	probably damaging	Het
Vav1	G	A	17: 57,297,122	E151K	probably damaging	Het
Vcan	T	G	13: 89,692,532	D1631A	probably benign	Het
Vmn2r4	A	C	3: 64,406,937	S208A	possibly damaging	Het
Zfp619	A	G	7: 39,537,218	T891A	possibly damaging	Het
Zfp672	A	G	11: 58,329,701		probably benign	Het
Znhit1	T	A	5: 136,982,381		probably null	Het

Other mutations in Tkt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tkt	APN	14	30569095	missense	probably damaging	1.00
IGL02122:Tkt	APN	14	30571201	missense	possibly damaging	0.95
IGL02323:Tkt	APN	14	30571035	missense	possibly damaging	0.69
IGL02326:Tkt	APN	14	30572225	missense	probably damaging	0.99
IGL02554:Tkt	APN	14	30558780	missense	probably damaging	1.00
IGL03145:Tkt	APN	14	30560688	splice site	probably benign
R0148:Tkt	UTSW	14	30572220	missense	probably damaging	1.00
R0732:Tkt	UTSW	14	30571140	splice site	probably null
R1550:Tkt	UTSW	14	30565568	missense	probably damaging	1.00
R2218:Tkt	UTSW	14	30567061	critical splice donor site	probably null
R4464:Tkt	UTSW	14	30568274	missense	possibly damaging	0.86
R4771:Tkt	UTSW	14	30567025	missense	probably damaging	0.97
R4998:Tkt	UTSW	14	30565542	nonsense	probably null
R5123:Tkt	UTSW	14	30565646	missense	probably benign	0.11
R5283:Tkt	UTSW	14	30560618	missense	probably damaging	1.00
R5777:Tkt	UTSW	14	30558776	missense	possibly damaging	0.88
R6051:Tkt	UTSW	14	30568196	missense	probably benign	0.27
R6517:Tkt	UTSW	14	30549323	missense	probably damaging	0.96
R6645:Tkt	UTSW	14	30570211	missense	probably damaging	1.00
R6722:Tkt	UTSW	14	30569084	missense	probably damaging	1.00
R7120:Tkt	UTSW	14	30559822	missense	probably benign	0.03
R7179:Tkt	UTSW	14	30559858	missense	probably damaging	1.00
R7272:Tkt	UTSW	14	30565607	missense	probably damaging	1.00
R7274:Tkt	UTSW	14	30569145	splice site	probably null
R7402:Tkt	UTSW	14	30558798	missense	probably damaging	1.00
R7423:Tkt	UTSW	14	30571035	missense	possibly damaging	0.69
R7522:Tkt	UTSW	14	30568223	missense	possibly damaging	0.52
R7712:Tkt	UTSW	14	30558806	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTATTGCATGCTGGGAGACG -3'
(R):5'- AAATCTCAGGTAGGAAAGCCC -3'

Sequencing Primer
(F):5'- CTGGGAGACGGGGAGGTC -3'
(R):5'- TCTCTAGGGGAGGAAGCCTGTC -3'

Posted On

2017-04-03