Incidental Mutation 'R5226:Tmem132a'
ID472461
Institutional Source Beutler Lab
Gene Symbol Tmem132a
Ensembl Gene ENSMUSG00000024736
Gene Nametransmembrane protein 132A
SynonymsHspa5bp1, 6720481D13Rik
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5226 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10857822-10869940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10867144 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000113696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025645] [ENSMUST00000038128] [ENSMUST00000120524] [ENSMUST00000133303]
Predicted Effect probably benign
Transcript: ENSMUST00000025645
AA Change: V30A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025645
Gene: ENSMUSG00000024736
AA Change: V30A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:TMEM132D_N 44 167 1.6e-35 PFAM
low complexity region 206 223 N/A INTRINSIC
Pfam:TMEM132 403 745 4.1e-108 PFAM
low complexity region 759 776 N/A INTRINSIC
Pfam:TMEM132D_C 809 897 1.5e-31 PFAM
low complexity region 906 923 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 960 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038128
SMART Domains Protein: ENSMUSP00000039529
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:BRI3BP 57 231 9.9e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120524
AA Change: V30A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113696
Gene: ENSMUSG00000024736
AA Change: V30A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133303
SMART Domains Protein: ENSMUSP00000120261
Gene: ENSMUSG00000034659

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:BRI3BP 54 213 8.1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138897
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the rat Grp78-binding protein (GBP). Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tlx2 C T 6: 83,068,930 G228D possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Tmem132a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Tmem132a APN 19 10861524 splice site probably benign
IGL02508:Tmem132a APN 19 10858518 missense probably damaging 1.00
R0514:Tmem132a UTSW 19 10858991 missense probably damaging 0.99
R0918:Tmem132a UTSW 19 10858113 missense probably damaging 1.00
R1160:Tmem132a UTSW 19 10858574 missense probably damaging 0.98
R1205:Tmem132a UTSW 19 10859084 missense probably benign 0.03
R1619:Tmem132a UTSW 19 10861698 missense probably damaging 1.00
R1777:Tmem132a UTSW 19 10858506 missense probably damaging 1.00
R1815:Tmem132a UTSW 19 10861567 nonsense probably null
R1869:Tmem132a UTSW 19 10858688 missense possibly damaging 0.48
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R2133:Tmem132a UTSW 19 10864066 missense probably benign 0.26
R2441:Tmem132a UTSW 19 10860137 missense probably damaging 0.96
R2570:Tmem132a UTSW 19 10859742 missense probably null 1.00
R3157:Tmem132a UTSW 19 10859537 nonsense probably null
R3159:Tmem132a UTSW 19 10859537 nonsense probably null
R4152:Tmem132a UTSW 19 10859063 missense probably benign 0.04
R4281:Tmem132a UTSW 19 10861726 missense possibly damaging 0.81
R4547:Tmem132a UTSW 19 10860200 missense possibly damaging 0.83
R4793:Tmem132a UTSW 19 10865493 missense probably damaging 1.00
R4947:Tmem132a UTSW 19 10866934 missense possibly damaging 0.90
R4998:Tmem132a UTSW 19 10858941 missense probably benign 0.02
R5323:Tmem132a UTSW 19 10864007 missense possibly damaging 0.81
R6659:Tmem132a UTSW 19 10860321 missense probably damaging 0.99
R6814:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R6872:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R7205:Tmem132a UTSW 19 10866931 missense probably damaging 1.00
R7383:Tmem132a UTSW 19 10866994 missense probably benign 0.01
R7505:Tmem132a UTSW 19 10858673 missense probably damaging 1.00
R7513:Tmem132a UTSW 19 10860128 missense probably damaging 0.98
R7595:Tmem132a UTSW 19 10858205 missense probably damaging 1.00
Z1088:Tmem132a UTSW 19 10858935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGCTGAGTGGCAAAGG -3'
(R):5'- CCAACTCTGACTGCTTTTAAGAG -3'

Sequencing Primer
(F):5'- CCGGAGAAGCGGCTGTG -3'
(R):5'- TTAAGAGGCTCTCAGTACCTCAG -3'
Posted On2017-04-06